EMAIL THIS PAGE TO A FRIEND

CT47A4

cancer/testis antigen family 47, member A4

12 Gene Product Result for
Synonyms: CT47.4
Species: Human CT47A4(728075)
Gene ID:
Human(728075) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080143 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314301 predicted 996
2 SASI_Hs02_00314302 predicted 940
3 SASI_Hs02_00314303 predicted 1023
4 SASI_Hs02_00314304 predicted 991
5 SASI_Hs02_00314305 predicted 953
6 SASI_Hs02_00314306 predicted 924
7 SASI_Hs02_00314307 predicted 944
8 SASI_Hs02_00314308 predicted 938
9 SASI_Hs02_00314309 predicted 930
10 SASI_Hs02_00314310 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080143
CT47A4 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-627s21c1
Sequence:CCGGGGACATGGTCCACTCCCTTCTCTCGAGAGAAGGGAGTGGACCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-668s21c1
Sequence:CCGGACCACATCCTCATAGAGAACCCTCGAGGGTTCTCTATGAGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-657s21c1
Sequence:CCGGCTCTCACAACGACCACATCCTCTCGAGAGGATGTGGTCGTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-1026s21c1
Sequence:CCGGGGATGAAGAGGCCCAAGATGCCTCGAGGCATCTTGGGCCTCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-680s21c1
Sequence:CCGGTAGAGAACCGTCAACTCAGCCCTCGAGGGCTGAGTTGACGGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080143
CT47A4 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-627s21c1
Sequence:CCGGGGACATGGTCCACTCCCTTCTCTCGAGAGAAGGGAGTGGACCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-668s21c1
Sequence:CCGGACCACATCCTCATAGAGAACCCTCGAGGGTTCTCTATGAGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-657s21c1
Sequence:CCGGCTCTCACAACGACCACATCCTCTCGAGAGGATGTGGTCGTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-1026s21c1
Sequence:CCGGGGATGAAGAGGCCCAAGATGCCTCGAGGCATCTTGGGCCTCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-680s21c1
Sequence:CCGGTAGAGAACCGTCAACTCAGCCCTCGAGGGCTGAGTTGACGGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080143
CT47A4 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-627s21c1
Sequence:CCGGGGACATGGTCCACTCCCTTCTCTCGAGAGAAGGGAGTGGACCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-668s21c1
Sequence:CCGGACCACATCCTCATAGAGAACCCTCGAGGGTTCTCTATGAGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-657s21c1
Sequence:CCGGCTCTCACAACGACCACATCCTCTCGAGAGGATGTGGTCGTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-1026s21c1
Sequence:CCGGGGATGAAGAGGCCCAAGATGCCTCGAGGCATCTTGGGCCTCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080143.1-680s21c1
Sequence:CCGGTAGAGAACCGTCAACTCAGCCCTCGAGGGCTGAGTTGACGGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks