EMAIL THIS PAGE TO A FRIEND

CT47A5

cancer/testis antigen family 47, member A5

12 Gene Product Result for
Synonyms: CT47.5
Species: Human CT47A5(728072)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080142 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314291 predicted 994
2 SASI_Hs02_00314292 predicted 936
3 SASI_Hs02_00314293 predicted 1019
4 SASI_Hs02_00314294 predicted 988
5 SASI_Hs02_00314295 predicted 958
6 SASI_Hs02_00314296 predicted 927
7 SASI_Hs02_00314297 predicted 937
8 SASI_Hs02_00314298 predicted 933
9 SASI_Hs02_00314299 predicted 937
10 SASI_Hs02_00314300 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080142
CT47A5 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1095s21c1
Sequence:CCGGCAAGGTGAAGAACTCCAAAGGCTCGAGCCTTTGGAGTTCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1027s21c1
Sequence:CCGGGATGAAGAGGCCCAAGATGCTCTCGAGAGCATCTTGGGCCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-661s21c1
Sequence:CCGGCACAACGACCACATCCTCATACTCGAGTATGAGGATGTGGTCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-992s21c1
Sequence:CCGGCAGAGGAAGTCACTAAATCTCCTCGAGGAGATTTAGTGACTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-673s21c1
Sequence:CCGGATCCTCATAGAGAACCGTCAACTCGAGTTGACGGTTCTCTATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080142
CT47A5 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1095s21c1
Sequence:CCGGCAAGGTGAAGAACTCCAAAGGCTCGAGCCTTTGGAGTTCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1027s21c1
Sequence:CCGGGATGAAGAGGCCCAAGATGCTCTCGAGAGCATCTTGGGCCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-661s21c1
Sequence:CCGGCACAACGACCACATCCTCATACTCGAGTATGAGGATGTGGTCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-992s21c1
Sequence:CCGGCAGAGGAAGTCACTAAATCTCCTCGAGGAGATTTAGTGACTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-673s21c1
Sequence:CCGGATCCTCATAGAGAACCGTCAACTCGAGTTGACGGTTCTCTATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080142
CT47A5 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1095s21c1
Sequence:CCGGCAAGGTGAAGAACTCCAAAGGCTCGAGCCTTTGGAGTTCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-1027s21c1
Sequence:CCGGGATGAAGAGGCCCAAGATGCTCTCGAGAGCATCTTGGGCCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-661s21c1
Sequence:CCGGCACAACGACCACATCCTCATACTCGAGTATGAGGATGTGGTCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-992s21c1
Sequence:CCGGCAGAGGAAGTCACTAAATCTCCTCGAGGAGATTTAGTGACTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080142.1-673s21c1
Sequence:CCGGATCCTCATAGAGAACCGTCAACTCGAGTTGACGGTTCTCTATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks