EMAIL THIS PAGE TO A FRIEND

CT47A6

cancer/testis antigen family 47, member A6

12 Gene Product Result for
Synonyms: CT47.6
Species: Human CT47A6(728062)
Gene ID:
Human(728062) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080141 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314281 predicted 1152
2 SASI_Hs02_00314282 predicted 1000
3 SASI_Hs02_00314283 predicted 1178
4 SASI_Hs02_00314284 predicted 930
5 SASI_Hs02_00314285 predicted 1178
6 SASI_Hs02_00314286 predicted 955
7 SASI_Hs02_00314287 predicted 1218
8 SASI_Hs02_00314288 predicted 602
9 SASI_Hs02_00314289 predicted 1020
10 SASI_Hs02_00314290 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080141
CT47A6 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-945s21c1
Sequence:CCGGAGAGGAACCAGCCACAGAAGACTCGAGTCTTCTGTGGCTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-665s21c1
Sequence:CCGGACGACCACATCCTCATAGAGACTCGAGTCTCTATGAGGATGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-1120s21c1
Sequence:CCGGTAGACGCAGCAGAGGTGAAGCCTCGAGGCTTCACCTCTGCTGCGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-996s21c1
Sequence:CCGGGGAAGTCACTAAATCTCAGCCCTCGAGGGCTGAGATTTAGTGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-677s21c1
Sequence:CCGGTCATAGAGAACCGTCAACTCACTCGAGTGAGTTGACGGTTCTCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080141
CT47A6 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-945s21c1
Sequence:CCGGAGAGGAACCAGCCACAGAAGACTCGAGTCTTCTGTGGCTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-665s21c1
Sequence:CCGGACGACCACATCCTCATAGAGACTCGAGTCTCTATGAGGATGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-1120s21c1
Sequence:CCGGTAGACGCAGCAGAGGTGAAGCCTCGAGGCTTCACCTCTGCTGCGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-996s21c1
Sequence:CCGGGGAAGTCACTAAATCTCAGCCCTCGAGGGCTGAGATTTAGTGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-677s21c1
Sequence:CCGGTCATAGAGAACCGTCAACTCACTCGAGTGAGTTGACGGTTCTCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080141
CT47A6 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-945s21c1
Sequence:CCGGAGAGGAACCAGCCACAGAAGACTCGAGTCTTCTGTGGCTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-665s21c1
Sequence:CCGGACGACCACATCCTCATAGAGACTCGAGTCTCTATGAGGATGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-1120s21c1
Sequence:CCGGTAGACGCAGCAGAGGTGAAGCCTCGAGGCTTCACCTCTGCTGCGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-996s21c1
Sequence:CCGGGGAAGTCACTAAATCTCAGCCCTCGAGGGCTGAGATTTAGTGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080141.1-677s21c1
Sequence:CCGGTCATAGAGAACCGTCAACTCACTCGAGTGAGTTGACGGTTCTCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks