EMAIL THIS PAGE TO A FRIEND

CT47A7

cancer/testis antigen family 47, member A7

Synonyms: CT47.7
Species: Human CT47A7(653282)
Gene ID:
Human(653282) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080140 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104031 MISSION® esiRNA esiRNA human AC008162.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080140 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314271 predicted 999
2 SASI_Hs02_00314272 predicted 939
3 SASI_Hs02_00314273 predicted 1018
4 SASI_Hs02_00314274 predicted 989
5 SASI_Hs02_00314275 predicted 957
6 SASI_Hs02_00314276 predicted 927
7 SASI_Hs02_00314277 predicted 940
8 SASI_Hs02_00314278 predicted 941
9 SASI_Hs02_00314279 predicted 938
10 SASI_Hs02_00314280 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080140
CT47A7 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-1041s21c1
Sequence:CCGGAGATGCTGCAGGCGAGGAAGACTCGAGTCTTCCTCGCCTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-993s21c1
Sequence:CCGGAGAGGAAGTCACTAAATCTCACTCGAGTGAGATTTAGTGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-666s21c1
Sequence:CCGGCGACCACATCCTCATAGAGAACTCGAGTTCTCTATGAGGATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-678s21c1
Sequence:CCGGCATAGAGAACCGTCAACTCAGCTCGAGCTGAGTTGACGGTTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-655s21c1
Sequence:CCGGCTCTCTCACAACGACCACATCCTCGAGGATGTGGTCGTTGTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080140
CT47A7 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-1041s21c1
Sequence:CCGGAGATGCTGCAGGCGAGGAAGACTCGAGTCTTCCTCGCCTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-993s21c1
Sequence:CCGGAGAGGAAGTCACTAAATCTCACTCGAGTGAGATTTAGTGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-666s21c1
Sequence:CCGGCGACCACATCCTCATAGAGAACTCGAGTTCTCTATGAGGATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-678s21c1
Sequence:CCGGCATAGAGAACCGTCAACTCAGCTCGAGCTGAGTTGACGGTTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-655s21c1
Sequence:CCGGCTCTCTCACAACGACCACATCCTCGAGGATGTGGTCGTTGTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080140
CT47A7 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-1041s21c1
Sequence:CCGGAGATGCTGCAGGCGAGGAAGACTCGAGTCTTCCTCGCCTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-993s21c1
Sequence:CCGGAGAGGAAGTCACTAAATCTCACTCGAGTGAGATTTAGTGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-666s21c1
Sequence:CCGGCGACCACATCCTCATAGAGAACTCGAGTTCTCTATGAGGATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-678s21c1
Sequence:CCGGCATAGAGAACCGTCAACTCAGCTCGAGCTGAGTTGACGGTTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080140.1-655s21c1
Sequence:CCGGCTCTCTCACAACGACCACATCCTCGAGGATGTGGTCGTTGTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks