EMAIL THIS PAGE TO A FRIEND

CT47A8

cancer/testis antigen family 47, member A8

12 Gene Product Result for
Synonyms: CT47.8
Species: Human CT47A8(728049)
Gene ID:
Human(728049) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080139 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314261 predicted 997
2 SASI_Hs02_00314262 predicted 936
3 SASI_Hs02_00314263 predicted 1016
4 SASI_Hs02_00314264 predicted 987
5 SASI_Hs02_00314265 predicted 954
6 SASI_Hs02_00314266 predicted 931
7 SASI_Hs02_00314267 predicted 944
8 SASI_Hs02_00314268 predicted 938
9 SASI_Hs02_00314269 predicted 932
10 SASI_Hs02_00314270 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080139
CT47A8 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1103s21c1
Sequence:CCGGAGAACTCCAAAGGGACCTAGACTCGAGTCTAGGTCCCTTTGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-656s21c1
Sequence:CCGGTCTCTCACAACGACCACATCCCTCGAGGGATGTGGTCGTTGTGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-674s21c1
Sequence:CCGGTCCTCATAGAGAACCGTCAACCTCGAGGTTGACGGTTCTCTATGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1028s21c1
Sequence:CCGGATGAAGAGGCCCAAGATGCTGCTCGAGCAGCATCTTGGGCCTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-994s21c1
Sequence:CCGGGAGGAAGTCACTAAATCTCAGCTCGAGCTGAGATTTAGTGACTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080139
CT47A8 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1103s21c1
Sequence:CCGGAGAACTCCAAAGGGACCTAGACTCGAGTCTAGGTCCCTTTGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-656s21c1
Sequence:CCGGTCTCTCACAACGACCACATCCCTCGAGGGATGTGGTCGTTGTGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-674s21c1
Sequence:CCGGTCCTCATAGAGAACCGTCAACCTCGAGGTTGACGGTTCTCTATGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1028s21c1
Sequence:CCGGATGAAGAGGCCCAAGATGCTGCTCGAGCAGCATCTTGGGCCTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-994s21c1
Sequence:CCGGGAGGAAGTCACTAAATCTCAGCTCGAGCTGAGATTTAGTGACTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080139
CT47A8 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1103s21c1
Sequence:CCGGAGAACTCCAAAGGGACCTAGACTCGAGTCTAGGTCCCTTTGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-656s21c1
Sequence:CCGGTCTCTCACAACGACCACATCCCTCGAGGGATGTGGTCGTTGTGAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-674s21c1
Sequence:CCGGTCCTCATAGAGAACCGTCAACCTCGAGGTTGACGGTTCTCTATGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-1028s21c1
Sequence:CCGGATGAAGAGGCCCAAGATGCTGCTCGAGCAGCATCTTGGGCCTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080139.1-994s21c1
Sequence:CCGGGAGGAAGTCACTAAATCTCAGCTCGAGCTGAGATTTAGTGACTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)