EMAIL THIS PAGE TO A FRIEND

CT47A9

cancer/testis antigen family 47, member A9

Synonyms: CT47.9
Species: Human CT47A9(728042)
Gene ID:
Human(728042) Summary: This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080138 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080138 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314251 predicted 998
2 SASI_Hs02_00314252 predicted 943
3 SASI_Hs02_00314253 predicted 1016
4 SASI_Hs02_00314254 predicted 989
5 SASI_Hs02_00314255 predicted 951
6 SASI_Hs02_00314256 predicted 927
7 SASI_Hs02_00314257 predicted 940
8 SASI_Hs02_00314258 predicted 939
9 SASI_Hs02_00314259 predicted 936
10 SASI_Hs02_00314260 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080138
CT47A9 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen family 47, member A9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-609s21c1
Sequence:CCGGCATTCACTTCGTGCTCCTGGACTCGAGTCCAGGAGCACGAAGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1098s21c1
Sequence:CCGGGGTGAAGAACTCCAAAGGGACCTCGAGGTCCCTTTGGAGTTCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-676s21c1
Sequence:CCGGCTCATAGAGAACCGTCAACTCCTCGAGGAGTTGACGGTTCTCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1000s21c1
Sequence:CCGGGTCACTAAATCTCAGCCCGAACTCGAGTTCGGGCTGAGATTTAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-660s21c1
Sequence:CCGGTCACAACGACCACATCCTCATCTCGAGATGAGGATGTGGTCGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080138
CT47A9 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen family 47, member A9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-609s21c1
Sequence:CCGGCATTCACTTCGTGCTCCTGGACTCGAGTCCAGGAGCACGAAGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1098s21c1
Sequence:CCGGGGTGAAGAACTCCAAAGGGACCTCGAGGTCCCTTTGGAGTTCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-676s21c1
Sequence:CCGGCTCATAGAGAACCGTCAACTCCTCGAGGAGTTGACGGTTCTCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1000s21c1
Sequence:CCGGGTCACTAAATCTCAGCCCGAACTCGAGTTCGGGCTGAGATTTAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-660s21c1
Sequence:CCGGTCACAACGACCACATCCTCATCTCGAGATGAGGATGTGGTCGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080138
CT47A9 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen family 47, member A9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-609s21c1
Sequence:CCGGCATTCACTTCGTGCTCCTGGACTCGAGTCCAGGAGCACGAAGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1098s21c1
Sequence:CCGGGGTGAAGAACTCCAAAGGGACCTCGAGGTCCCTTTGGAGTTCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-676s21c1
Sequence:CCGGCTCATAGAGAACCGTCAACTCCTCGAGGAGTTGACGGTTCTCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-1000s21c1
Sequence:CCGGGTCACTAAATCTCAGCCCGAACTCGAGTTCGGGCTGAGATTTAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080138.1-660s21c1
Sequence:CCGGTCACAACGACCACATCCTCATCTCGAGATGAGGATGTGGTCGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks