EMAIL THIS PAGE TO A FRIEND

CT62

cancer/testis antigen 62

Species: Human CT62(196993), naked mole-rat Ct62(101724936)
UniProtKB ID: P0C5K7
Gene ID:
naked mole-rat(101724936) cancer/testis antigen 62
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102658 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222241 MISSION® esiRNA esiRNA targeting human CT62 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102658 Rosetta Predictions human pricing
XM_933776 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323470 predicted 587
2 SASI_Hs02_00323471 predicted 836
3 SASI_Hs02_00323472 predicted 927
4 SASI_Hs02_00323473 predicted 693
5 SASI_Hs02_00323474 predicted 934
6 SASI_Hs02_00323475 predicted 993
7 SASI_Hs02_00323476 predicted 956
8 SASI_Hs02_00323477 predicted 517
9 SASI_Hs02_00323478 predicted 798
10 SASI_Hs02_00323479 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252356 predicted 770
2 SASI_Hs01_00252357 predicted 782
3 SASI_Hs01_00252358 predicted 682
4 SASI_Hs01_00252359 predicted 790
5 SASI_Hs01_00252360 predicted 511
6 SASI_Hs01_00252361 predicted 783
7 SASI_Hs01_00252362 predicted 587
8 SASI_Hs01_00252363 predicted 796
9 SASI_Hs01_00252364 predicted 833
10 SASI_Hs01_00252365 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102658
CT62 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 62
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-703s21c1
Sequence:CCGGACTCTCTACTTGACCTGTAACCTCGAGGTTACAGGTCAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102658.1-1235s21c1
Sequence:CCGGAGCCAACTATGAACGACTAAACTCGAGTTTAGTCGTTCATAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-588s21c1
Sequence:CCGGCCACAGAACATTCAGCCATTTCTCGAGAAATGGCTGAATGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-829s21c1
Sequence:CCGGCAGGCCACACTTCAGGTTATCCTCGAGGATAACCTGAAGTGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-919s21c1
Sequence:CCGGAGATAGGAAGGTTCTTGTTACCTCGAGGTAACAAGAACCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102658
CT62 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 62
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-703s21c1
Sequence:CCGGACTCTCTACTTGACCTGTAACCTCGAGGTTACAGGTCAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102658.1-1235s21c1
Sequence:CCGGAGCCAACTATGAACGACTAAACTCGAGTTTAGTCGTTCATAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-588s21c1
Sequence:CCGGCCACAGAACATTCAGCCATTTCTCGAGAAATGGCTGAATGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-829s21c1
Sequence:CCGGCAGGCCACACTTCAGGTTATCCTCGAGGATAACCTGAAGTGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-919s21c1
Sequence:CCGGAGATAGGAAGGTTCTTGTTACCTCGAGGTAACAAGAACCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102658
CT62 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 62
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-703s21c1
Sequence:CCGGACTCTCTACTTGACCTGTAACCTCGAGGTTACAGGTCAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102658.1-1235s21c1
Sequence:CCGGAGCCAACTATGAACGACTAAACTCGAGTTTAGTCGTTCATAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-588s21c1
Sequence:CCGGCCACAGAACATTCAGCCATTTCTCGAGAAATGGCTGAATGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-829s21c1
Sequence:CCGGCAGGCCACACTTCAGGTTATCCTCGAGGATAACCTGAAGTGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102658.1-919s21c1
Sequence:CCGGAGATAGGAAGGTTCTTGTTACCTCGAGGTAACAAGAACCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks