EMAIL THIS PAGE TO A FRIEND

CTAG1B

cancer/testis antigen 1B

18 Gene Product Result for
Synonyms: CT6.1 CTAG CTAG1 ESO1 LAGE-2 LAGE2B NY-ESO-1
Species: Human CTAG1B(1485)
Gene ID:
Human(1485) Summary: The protein encoded by this gene is an antigen that is overexpressed in many cancers but that is also expressed in normal testis. This gene is found in a duplicated region of the X-chromosome and therefore has a neighboring gene of identical sequence. [provided by RefSeq, Jan 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001327 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128361 MISSION® esiRNA esiRNA human CTAG1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001327 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097568 predicted 277
2 SASI_Hs01_00097569 predicted 296
3 SASI_Hs01_00097570 predicted 288
4 SASI_Hs01_00097571 predicted 359
5 SASI_Hs01_00097572 predicted 340
6 SASI_Hs01_00097573 predicted 277
7 SASI_Hs01_00097574 predicted 471
8 SASI_Hs01_00097575 predicted 333
9 SASI_Hs01_00097576 predicted 459
10 SASI_Hs01_00097577 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001327
CTAG1B MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 1B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-472s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-547s1c1
Sequence:CCGGCCAGCAGCTTTCCCTGTTGATCTCGAGATCAACAGGGAAAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-349s1c1
Sequence:CCGGGCTTGAGTTCTACCTCGCCATCTCGAGATGGCGAGGTAGAACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-320s21c1
Sequence:CCGGGTTCTACCTCGCCATGCCTTTCTCGAGAAAGGCATGGCGAGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-429s21c1
Sequence:CCGGTTCACTGTGTCCGGCAACATACTCGAGTATGTTGCCGGACACAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-438s21c1
Sequence:CCGGTCCGGCAACATACTGACTATCCTCGAGGATAGTCAGTATGTTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-533s21c1
Sequence:CCGGGTGGATCACGCAGTGCTTTCTCTCGAGAGAAAGCACTGCGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001327
CTAG1B MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 1B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-472s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-547s1c1
Sequence:CCGGCCAGCAGCTTTCCCTGTTGATCTCGAGATCAACAGGGAAAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-349s1c1
Sequence:CCGGGCTTGAGTTCTACCTCGCCATCTCGAGATGGCGAGGTAGAACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-320s21c1
Sequence:CCGGGTTCTACCTCGCCATGCCTTTCTCGAGAAAGGCATGGCGAGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-429s21c1
Sequence:CCGGTTCACTGTGTCCGGCAACATACTCGAGTATGTTGCCGGACACAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-438s21c1
Sequence:CCGGTCCGGCAACATACTGACTATCCTCGAGGATAGTCAGTATGTTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-533s21c1
Sequence:CCGGGTGGATCACGCAGTGCTTTCTCTCGAGAGAAAGCACTGCGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001327
CTAG1B MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 1B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-472s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-547s1c1
Sequence:CCGGCCAGCAGCTTTCCCTGTTGATCTCGAGATCAACAGGGAAAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001327.1-349s1c1
Sequence:CCGGGCTTGAGTTCTACCTCGCCATCTCGAGATGGCGAGGTAGAACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-320s21c1
Sequence:CCGGGTTCTACCTCGCCATGCCTTTCTCGAGAAAGGCATGGCGAGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-429s21c1
Sequence:CCGGTTCACTGTGTCCGGCAACATACTCGAGTATGTTGCCGGACACAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-438s21c1
Sequence:CCGGTCCGGCAACATACTGACTATCCTCGAGGATAGTCAGTATGTTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001327.2-533s21c1
Sequence:CCGGGTGGATCACGCAGTGCTTTCTCTCGAGAGAAAGCACTGCGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks