EMAIL THIS PAGE TO A FRIEND

CTAG2

cancer/testis antigen 2

92 Gene Product Result for
Synonyms: CAMEL CT2 CT6.2 CT6.2a CT6.2b ESO2 LAGE-1 LAGE2B
Gene ID:
Human(30848) Summary: This gene encodes an autoimmunogenic tumor antigen that belongs to the ESO/LAGE family of cancer-testis antigens. This protein is expressed in a wide array of cancers including melanoma, breast cancer, bladder cancer and prostate cancer. This protein is also expressed in normal testis tissue. An alternative open reading frame product of this gene has been described in PMID 10399963. This alternate protein, termed CAMEL, is a tumor antigen that is recognized by melanoma-specific cytotoxic T-lymphocytes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(70062) cancer/testis antigen 2
Rat(501655) cancer/testis antigen 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001161821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001161821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001161821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157141 MISSION® esiRNA esiRNA human CTAG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020994 Rosetta Predictions human pricing
NM_172377 Rosetta Predictions human pricing
NM_001109322 Rosetta Predictions rat pricing
NM_027302 Rosetta Predictions mouse pricing
XR_035223 Rosetta Predictions mouse pricing
XR_035228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134407 predicted 636
2 SASI_Hs01_00134408 predicted 433
3 SASI_Hs02_00354457 predicted 709
4 SASI_Hs02_00354458 predicted 255
5 SASI_Hs01_00134409 predicted 434
6 SASI_Hs01_00134410 predicted 570
7 SASI_Hs01_00134411 predicted 629
8 SASI_Hs01_00134412 predicted 551
9 SASI_Hs01_00134413 predicted 421
10 SASI_Hs01_00134414 predicted 445
11 SASI_Hs01_00134406 predicted 635
12 SASI_Hs01_00134415 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039835 predicted 302
2 SASI_Hs01_00039836 predicted 310
3 SASI_Hs01_00039837 predicted 324
4 SASI_Hs01_00039838 predicted 425
5 SASI_Hs01_00039839 predicted 437
6 SASI_Hs01_00039840 predicted 300
7 SASI_Hs01_00039843 predicted 248
8 SASI_Hs01_00039844 predicted 441
9 SASI_Hs02_00368030 predicted 253
10 SASI_Hs02_00368031 predicted 295
11 SASI_Hs01_00039841 predicted 247
12 SASI_Hs01_00039842 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247284 predicted 472
2 SASI_Rn02_00247285 predicted 231
3 SASI_Rn02_00247286 predicted 465
4 SASI_Rn02_00247287 predicted 236
5 SASI_Rn02_00247288 predicted 523
6 SASI_Rn02_00247289 predicted 549
7 SASI_Rn02_00247290 predicted 481
8 SASI_Rn02_00247291 predicted 488
9 SASI_Rn02_00247292 predicted 291
10 SASI_Rn02_00247293 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131929 predicted 463
2 SASI_Mm01_00131930 predicted 429
3 SASI_Mm01_00131931 predicted 593
4 SASI_Mm01_00131932 predicted 583
5 SASI_Mm01_00131933 predicted 404
6 SASI_Mm01_00131934 predicted 547
7 SASI_Mm01_00131935 predicted 481
8 SASI_Mm01_00131936 predicted 476
9 SASI_Mm01_00131937 predicted 580
10 SASI_Mm01_00131938 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480673 predicted 464
2 SASI_Mm02_00480674 predicted 436
3 SASI_Mm02_00480675 predicted 586
4 SASI_Mm02_00480676 predicted 604
5 SASI_Mm02_00480677 predicted 547
6 SASI_Mm02_00480678 predicted 207
7 SASI_Mm02_00480679 predicted 552
8 SASI_Mm02_00480680 predicted 574
9 SASI_Mm02_00480681 predicted 539
10 SASI_Mm02_00480682 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480723 predicted 465
2 SASI_Mm02_00480724 predicted 430
3 SASI_Mm02_00480725 predicted 583
4 SASI_Mm02_00480726 predicted 607
5 SASI_Mm02_00480727 predicted 556
6 SASI_Mm02_00480728 predicted 200
7 SASI_Mm02_00480729 predicted 548
8 SASI_Mm02_00480730 predicted 577
9 SASI_Mm02_00480731 predicted 543
10 SASI_Mm02_00480732 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020994
CTAG2 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-569s21c1
Sequence:CCGGACACAAGGTCTCAGAACAGAGCTCGAGCTCTGTTCTGAGACCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-580s21c1
Sequence:CCGGCAGAACAGAGACCTGGTACACCTCGAGGTGTACCAGGTCTCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-539s21c1
Sequence:CCGGGCAGAAAGCTAGAGATCTCAGCTCGAGCTGAGATCTCTAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020994.2-747s1c1
Sequence:CCGGGCTTTCCCTGTTGATGTGGATCTCGAGATCCACATCAACAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-320s1c1
Sequence:CCGGGTTGCACATCACGATGCCTTTCTCGAGAAAGGCATCGTGATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-647s1c1
Sequence:CCGGTGTCGCCTTTAATGTGATGTTCTCGAGAACATCACATTAAAGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-314s1c1
Sequence:CCGGGCTTCAGTTGCACATCACGATCTCGAGATCGTGATGTGCAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-437s1c1
Sequence:CCGGGTCCGGCAACCTACTGTTTATCTCGAGATAAACAGTAGGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020994
CTAG2 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-569s21c1
Sequence:CCGGACACAAGGTCTCAGAACAGAGCTCGAGCTCTGTTCTGAGACCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-580s21c1
Sequence:CCGGCAGAACAGAGACCTGGTACACCTCGAGGTGTACCAGGTCTCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-539s21c1
Sequence:CCGGGCAGAAAGCTAGAGATCTCAGCTCGAGCTGAGATCTCTAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020994.2-747s1c1
Sequence:CCGGGCTTTCCCTGTTGATGTGGATCTCGAGATCCACATCAACAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-320s1c1
Sequence:CCGGGTTGCACATCACGATGCCTTTCTCGAGAAAGGCATCGTGATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-647s1c1
Sequence:CCGGTGTCGCCTTTAATGTGATGTTCTCGAGAACATCACATTAAAGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-314s1c1
Sequence:CCGGGCTTCAGTTGCACATCACGATCTCGAGATCGTGATGTGCAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-437s1c1
Sequence:CCGGGTCCGGCAACCTACTGTTTATCTCGAGATAAACAGTAGGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020994
CTAG2 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-569s21c1
Sequence:CCGGACACAAGGTCTCAGAACAGAGCTCGAGCTCTGTTCTGAGACCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-580s21c1
Sequence:CCGGCAGAACAGAGACCTGGTACACCTCGAGGTGTACCAGGTCTCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020994.2-539s21c1
Sequence:CCGGGCAGAAAGCTAGAGATCTCAGCTCGAGCTGAGATCTCTAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020994.2-747s1c1
Sequence:CCGGGCTTTCCCTGTTGATGTGGATCTCGAGATCCACATCAACAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-320s1c1
Sequence:CCGGGTTGCACATCACGATGCCTTTCTCGAGAAAGGCATCGTGATGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-647s1c1
Sequence:CCGGTGTCGCCTTTAATGTGATGTTCTCGAGAACATCACATTAAAGGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-314s1c1
Sequence:CCGGGCTTCAGTTGCACATCACGATCTCGAGATCGTGATGTGCAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020994.2-437s1c1
Sequence:CCGGGTCCGGCAACCTACTGTTTATCTCGAGATAAACAGTAGGTTGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001161821
CTAG2 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-234s21c1
Sequence:CCGGGATAACTCTCCACATGTAAATCTCGAGATTTACATGTGGAGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-482s21c1
Sequence:CCGGCAGAACCCTGGCCTCAAATATCTCGAGATATTTGAGGCCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-535s21c1
Sequence:CCGGTCACTGTCAATGACACTATTCCTCGAGGAATAGTGTCATTGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161821.1-716s21c1
Sequence:CCGGCACAACACAAGGCAAAGGCATCTCGAGATGCCTTTGCCTTGTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-359s21c1
Sequence:CCGGGGGTGAGCAGGCACCAATTATCTCGAGATAATTGGTGCCTGCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001161821
CTAG2 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-234s21c1
Sequence:CCGGGATAACTCTCCACATGTAAATCTCGAGATTTACATGTGGAGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-482s21c1
Sequence:CCGGCAGAACCCTGGCCTCAAATATCTCGAGATATTTGAGGCCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-535s21c1
Sequence:CCGGTCACTGTCAATGACACTATTCCTCGAGGAATAGTGTCATTGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161821.1-716s21c1
Sequence:CCGGCACAACACAAGGCAAAGGCATCTCGAGATGCCTTTGCCTTGTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-359s21c1
Sequence:CCGGGGGTGAGCAGGCACCAATTATCTCGAGATAATTGGTGCCTGCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001161821
CTAG2 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-234s21c1
Sequence:CCGGGATAACTCTCCACATGTAAATCTCGAGATTTACATGTGGAGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-482s21c1
Sequence:CCGGCAGAACCCTGGCCTCAAATATCTCGAGATATTTGAGGCCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-535s21c1
Sequence:CCGGTCACTGTCAATGACACTATTCCTCGAGGAATAGTGTCATTGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161821.1-716s21c1
Sequence:CCGGCACAACACAAGGCAAAGGCATCTCGAGATGCCTTTGCCTTGTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161821.1-359s21c1
Sequence:CCGGGGGTGAGCAGGCACCAATTATCTCGAGATAATTGGTGCCTGCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027302
CTAG2 MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000201460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-588s1c1
Sequence:CCGGCGAACATCCATCAATGCCTTTCTCGAGAAAGGCATTGATGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027302.1-715s1c1
Sequence:CCGGCACAAGGCAAAGGCATTTCATCTCGAGATGAAATGCCTTTGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-120s1c1
Sequence:CCGGGATACTGAAGCAGACCCACATCTCGAGATGTGGGTCTGCTTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027302
CTAG2 MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000201460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-588s1c1
Sequence:CCGGCGAACATCCATCAATGCCTTTCTCGAGAAAGGCATTGATGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027302.1-715s1c1
Sequence:CCGGCACAAGGCAAAGGCATTTCATCTCGAGATGAAATGCCTTTGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-120s1c1
Sequence:CCGGGATACTGAAGCAGACCCACATCTCGAGATGTGGGTCTGCTTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027302
CTAG2 MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000201460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-588s1c1
Sequence:CCGGCGAACATCCATCAATGCCTTTCTCGAGAAAGGCATTGATGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027302.1-715s1c1
Sequence:CCGGCACAAGGCAAAGGCATTTCATCTCGAGATGAAATGCCTTTGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027302.1-120s1c1
Sequence:CCGGGATACTGAAGCAGACCCACATCTCGAGATGTGGGTCTGCTTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks