EMAIL THIS PAGE TO A FRIEND

CTAGE15

CTAGE family, member 15

4 Gene Product Result for
Synonyms: CTAGE15P cTAGE-15
Species: Human CTAGE15(441294)
UniProtKB ID: A4D2H0, A6H8Z8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008747 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015646 predicted 145
2 SASI_Hs01_00015645 predicted 103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008747
CTAGE15 MISSION shRNA Bacterial Glycerol Stock
CTAGE family, member 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-508s1c1
Sequence:CCGGCAAGATGAATTGATGGCGGATCTCGAGATCCGCCATCAATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-784s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1436s1c1
Sequence:CCGGCTGAAAGAAACCTCAGTGATTCTCGAGAATCACTGAGGTTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1739s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-2129s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-712s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGACAACTCGAGTTGTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1435s1c1
Sequence:CCGGGCTGAAAGAAACCTCAGTGATCTCGAGATCACTGAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1380s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1607s1c1
Sequence:CCGGGTTCATCTGAAACGAGAGCTTCTCGAGAAGCTCTCGTTTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-884s1c1
Sequence:CCGGCGGATGATGATAACCTGGAATCTCGAGATTCCAGGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008747
CTAGE15 MISSION shRNA shRNA Plasmid DNA
CTAGE family, member 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-508s1c1
Sequence:CCGGCAAGATGAATTGATGGCGGATCTCGAGATCCGCCATCAATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-784s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1436s1c1
Sequence:CCGGCTGAAAGAAACCTCAGTGATTCTCGAGAATCACTGAGGTTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1739s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-2129s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-712s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGACAACTCGAGTTGTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1435s1c1
Sequence:CCGGGCTGAAAGAAACCTCAGTGATCTCGAGATCACTGAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1380s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1607s1c1
Sequence:CCGGGTTCATCTGAAACGAGAGCTTCTCGAGAAGCTCTCGTTTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-884s1c1
Sequence:CCGGCGGATGATGATAACCTGGAATCTCGAGATTCCAGGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008747
CTAGE15 MISSION shRNA Lentiviral Transduction Particles
CTAGE family, member 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-508s1c1
Sequence:CCGGCAAGATGAATTGATGGCGGATCTCGAGATCCGCCATCAATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-784s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1436s1c1
Sequence:CCGGCTGAAAGAAACCTCAGTGATTCTCGAGAATCACTGAGGTTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1739s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-2129s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-712s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGACAACTCGAGTTGTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1435s1c1
Sequence:CCGGGCTGAAAGAAACCTCAGTGATCTCGAGATCACTGAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1380s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-1607s1c1
Sequence:CCGGGTTCATCTGAAACGAGAGCTTCTCGAGAAGCTCTCGTTTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008747.1-884s1c1
Sequence:CCGGCGGATGATGATAACCTGGAATCTCGAGATTCCAGGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks