EMAIL THIS PAGE TO A FRIEND

CTAGE1

cutaneous T-cell lymphoma-associated antigen 1

83 Gene Product Result for
Synonyms: CT21.1 CT21.2 CTAGE CTAGE-1 CTAGE-2
Species: Human CTAGE1(64693)
UniProtKB ID: Q96RT6, A2RUF2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172241 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217791 MISSION® esiRNA esiRNA targeting human CTAGE1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172241 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054202 predicted 2100
2 SASI_Hs01_00054203 predicted 2404
3 SASI_Hs01_00054204 predicted 590
4 SASI_Hs01_00054206 predicted 1626
5 SASI_Hs01_00054207 predicted 1320
6 SASI_Hs01_00054208 predicted 593
7 SASI_Hs01_00054205 predicted 1014
8 SASI_Hs02_00367955 predicted 2329
9 SASI_Hs01_00054209 predicted 2095
10 SASI_Hs01_00054210 predicted 111
11 SASI_Hs01_00054211 predicted 184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022663
CTAGE1 MISSION shRNA Bacterial Glycerol Stock
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-108s1c1
Sequence:CCGGCCCAGAATTATATAGATCAGTCTCGAGACTGATCTATATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-76s1c1
Sequence:CCGGTGGGAACAACTTTATCCAGAACTCGAGTTCTGGATAAAGTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-159s1c1
Sequence:CCGGCTGTTGGTGTTCTAATAGTTTCTCGAGAAACTATTAGAACACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-134s1c1
Sequence:CCGGCTGACTTCTTTCCCAACCTTTCTCGAGAAAGGTTGGGAAAGAAGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022663.1-720s1c1
Sequence:CCGGCCTTCACTGTTGAATACTATTCTCGAGAATAGTATTCAACAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022663
CTAGE1 MISSION shRNA shRNA Plasmid DNA
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-108s1c1
Sequence:CCGGCCCAGAATTATATAGATCAGTCTCGAGACTGATCTATATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-76s1c1
Sequence:CCGGTGGGAACAACTTTATCCAGAACTCGAGTTCTGGATAAAGTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-159s1c1
Sequence:CCGGCTGTTGGTGTTCTAATAGTTTCTCGAGAAACTATTAGAACACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-134s1c1
Sequence:CCGGCTGACTTCTTTCCCAACCTTTCTCGAGAAAGGTTGGGAAAGAAGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022663.1-720s1c1
Sequence:CCGGCCTTCACTGTTGAATACTATTCTCGAGAATAGTATTCAACAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022663
CTAGE1 MISSION shRNA Lentiviral Transduction Particles
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-108s1c1
Sequence:CCGGCCCAGAATTATATAGATCAGTCTCGAGACTGATCTATATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-76s1c1
Sequence:CCGGTGGGAACAACTTTATCCAGAACTCGAGTTCTGGATAAAGTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-159s1c1
Sequence:CCGGCTGTTGGTGTTCTAATAGTTTCTCGAGAAACTATTAGAACACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022663.1-134s1c1
Sequence:CCGGCTGACTTCTTTCCCAACCTTTCTCGAGAAAGGTTGGGAAAGAAGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022663.1-720s1c1
Sequence:CCGGCCTTCACTGTTGAATACTATTCTCGAGAATAGTATTCAACAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172241
CTAGE1 MISSION shRNA Bacterial Glycerol Stock
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-879s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-2121s1c1
Sequence:CCGGGTTTATTGTTTCCGGTAGATACTCGAGTATCTACCGGAAACAATAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-336s1c1
Sequence:CCGGGCTATGAAGTAGAGTCATCTTCTCGAGAAGATGACTCTACTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-1427s1c1
Sequence:CCGGGCTGAAAGAAACCTCAATGATCTCGAGATCATTGAGGTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172241.1-3049s1c1
Sequence:CCGGCCCTAAGCTAATTTCTTCCTACTCGAGTAGGAAGAAATTAGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172241
CTAGE1 MISSION shRNA shRNA Plasmid DNA
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-879s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-2121s1c1
Sequence:CCGGGTTTATTGTTTCCGGTAGATACTCGAGTATCTACCGGAAACAATAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-336s1c1
Sequence:CCGGGCTATGAAGTAGAGTCATCTTCTCGAGAAGATGACTCTACTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-1427s1c1
Sequence:CCGGGCTGAAAGAAACCTCAATGATCTCGAGATCATTGAGGTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172241.1-3049s1c1
Sequence:CCGGCCCTAAGCTAATTTCTTCCTACTCGAGTAGGAAGAAATTAGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172241
CTAGE1 MISSION shRNA Lentiviral Transduction Particles
cutaneous T-cell lymphoma-associated antigen 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-879s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-2121s1c1
Sequence:CCGGGTTTATTGTTTCCGGTAGATACTCGAGTATCTACCGGAAACAATAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-336s1c1
Sequence:CCGGGCTATGAAGTAGAGTCATCTTCTCGAGAAGATGACTCTACTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172241.1-1427s1c1
Sequence:CCGGGCTGAAAGAAACCTCAATGATCTCGAGATCATTGAGGTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172241.1-3049s1c1
Sequence:CCGGCCCTAAGCTAATTTCTTCCTACTCGAGTAGGAAGAAATTAGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks