EMAIL THIS PAGE TO A FRIEND

CTAGE5

CTAGE family, member 5

99 Gene Product Result for
Synonyms: MEA6 MGEA MGEA11 MGEA6
Gene ID:
Human(4253) Summary: The protein encoded by this gene is a tumor-associated antigen found in cutaneous T-cell lymphoma and several other cancers. Autoantibodies against the encoded protein have been found in some cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(217615) CTAGE family, member 5
Rat(299078) CTAGE family, member 5
Zebrafish(393281) CTAGE family, member 5
chicken(771686) CTAGE family, member 5
dog(480298) CTAGE family, member 5
cow(513132) CTAGE family, member 5
domestic cat(101088002) CTAGE family, member 5
sheep(101102181) CTAGE family, member 5
domestic guinea pig(100733236) CTAGE family, member 5
naked mole-rat(101722633) CTAGE family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005930 Rosetta Predictions human pricing
NM_203354 Rosetta Predictions human pricing
NM_203355 Rosetta Predictions human pricing
NM_203356 Rosetta Predictions human pricing
NM_203357 Rosetta Predictions human pricing
NM_001106734 Rosetta Predictions rat pricing
NM_146034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134400 predicted 2683
2 SASI_Hs01_00134401 predicted 2687
3 SASI_Hs01_00134402 predicted 416
4 SASI_Hs01_00134403 predicted 2081
5 SASI_Hs01_00134405 predicted 1798
6 SASI_Hs01_00134404 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201407 predicted 2430
2 SASI_Hs01_00201408 predicted 2433
3 SASI_Hs01_00201409 predicted 167
4 SASI_Hs01_00201410 predicted 1833
5 SASI_Hs01_00201412 predicted 1547
6 SASI_Hs01_00201411 predicted 181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247125 predicted 2552
2 SASI_Hs01_00247126 predicted 2556
3 SASI_Hs01_00247127 predicted 418
4 SASI_Hs01_00247128 predicted 1960
5 SASI_Hs01_00247130 predicted 1796
6 SASI_Hs01_00247129 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104452 predicted 2515
2 SASI_Hs01_00104453 predicted 2515
3 SASI_Hs01_00104454 predicted 1914
4 SASI_Hs01_00104456 predicted 1628
5 SASI_Hs01_00104455 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041727 predicted 2573
2 SASI_Hs01_00041728 predicted 2571
3 SASI_Hs01_00041729 predicted 582
4 SASI_Hs01_00041730 predicted 1978
5 SASI_Hs01_00041731 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221868 predicted 260
2 SASI_Rn02_00221869 predicted 156
3 SASI_Rn02_00221870 predicted 172
4 SASI_Rn02_00221871 predicted 258
5 SASI_Rn02_00221872 predicted 222
6 SASI_Rn02_00221873 predicted 198
7 SASI_Rn02_00221874 predicted 259
8 SASI_Rn02_00221875 predicted 159
9 SASI_Rn02_00221876 predicted 403
10 SASI_Rn02_00221877 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068474 predicted 2222
2 SASI_Mm01_00068475 predicted 222
3 SASI_Mm01_00068476 predicted 667
4 SASI_Mm01_00068477 predicted 1685
5 SASI_Mm01_00068478 predicted 338
6 SASI_Mm01_00068479 predicted 2537
7 SASI_Mm01_00068480 predicted 2040
8 SASI_Mm02_00341626 predicted 763
9 SASI_Mm01_00068481 predicted 2545
10 SASI_Mm01_00068482 predicted 866
11 SASI_Mm01_00068483 predicted 1771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005930
CTAGE5 MISSION shRNA Bacterial Glycerol Stock
CTAGE family, member 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-2662s1c1
Sequence:CCGGCCTCAGGTTTGATTCCACCTTCTCGAGAAGGTGGAATCAAACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-408s1c1
Sequence:CCGGCCAGATTCTAATCTTTATGGTCTCGAGACCATAAAGATTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1668s1c1
Sequence:CCGGCAGATTATTTCCCATGAGAAACTCGAGTTTCTCATGGGAAATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1171s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1248s1c1
Sequence:CCGGGCTTTGAAGAAACTGATTCATCTCGAGATGAATCAGTTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-1667s1c1
Sequence:CCGGGCAGATTATTTCCCATGAGAACTCGAGTTCTCATGGGAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3408s1c1
Sequence:CCGGGCACGGTTTCTTTATTGCTTTCTCGAGAAAGCAATAAAGAAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3288s1c1
Sequence:CCGGGCCCAAAGCAACAAATTAATACTCGAGTATTAATTTGTTGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-2311s1c1
Sequence:CCGGCCAAAGATGATCTTGGTAATTCTCGAGAATTACCAAGATCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3189s1c1
Sequence:CCGGCCAATAACTTTGAGGTGCAAACTCGAGTTTGCACCTCAAAGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-549s1c1
Sequence:CCGGGCTCTAATGCTTTCTGGACTACTCGAGTAGTCCAGAAAGCATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1662s1c1
Sequence:CCGGCAAGGGCAGATTATTTCCCATCTCGAGATGGGAAATAATCTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005930
CTAGE5 MISSION shRNA shRNA Plasmid DNA
CTAGE family, member 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-2662s1c1
Sequence:CCGGCCTCAGGTTTGATTCCACCTTCTCGAGAAGGTGGAATCAAACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-408s1c1
Sequence:CCGGCCAGATTCTAATCTTTATGGTCTCGAGACCATAAAGATTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1668s1c1
Sequence:CCGGCAGATTATTTCCCATGAGAAACTCGAGTTTCTCATGGGAAATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1171s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1248s1c1
Sequence:CCGGGCTTTGAAGAAACTGATTCATCTCGAGATGAATCAGTTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-1667s1c1
Sequence:CCGGGCAGATTATTTCCCATGAGAACTCGAGTTCTCATGGGAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3408s1c1
Sequence:CCGGGCACGGTTTCTTTATTGCTTTCTCGAGAAAGCAATAAAGAAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3288s1c1
Sequence:CCGGGCCCAAAGCAACAAATTAATACTCGAGTATTAATTTGTTGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-2311s1c1
Sequence:CCGGCCAAAGATGATCTTGGTAATTCTCGAGAATTACCAAGATCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3189s1c1
Sequence:CCGGCCAATAACTTTGAGGTGCAAACTCGAGTTTGCACCTCAAAGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-549s1c1
Sequence:CCGGGCTCTAATGCTTTCTGGACTACTCGAGTAGTCCAGAAAGCATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1662s1c1
Sequence:CCGGCAAGGGCAGATTATTTCCCATCTCGAGATGGGAAATAATCTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005930
CTAGE5 MISSION shRNA Lentiviral Transduction Particles
CTAGE family, member 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-2662s1c1
Sequence:CCGGCCTCAGGTTTGATTCCACCTTCTCGAGAAGGTGGAATCAAACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-408s1c1
Sequence:CCGGCCAGATTCTAATCTTTATGGTCTCGAGACCATAAAGATTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1668s1c1
Sequence:CCGGCAGATTATTTCCCATGAGAAACTCGAGTTTCTCATGGGAAATAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1171s1c1
Sequence:CCGGCGGATGATGATAACTTGGAATCTCGAGATTCCAAGTTATCATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1248s1c1
Sequence:CCGGGCTTTGAAGAAACTGATTCATCTCGAGATGAATCAGTTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-1667s1c1
Sequence:CCGGGCAGATTATTTCCCATGAGAACTCGAGTTCTCATGGGAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3408s1c1
Sequence:CCGGGCACGGTTTCTTTATTGCTTTCTCGAGAAAGCAATAAAGAAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3288s1c1
Sequence:CCGGGCCCAAAGCAACAAATTAATACTCGAGTATTAATTTGTTGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005930.2-2311s1c1
Sequence:CCGGCCAAAGATGATCTTGGTAATTCTCGAGAATTACCAAGATCATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005930.2-3189s1c1
Sequence:CCGGCCAATAACTTTGAGGTGCAAACTCGAGTTTGCACCTCAAAGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-549s1c1
Sequence:CCGGGCTCTAATGCTTTCTGGACTACTCGAGTAGTCCAGAAAGCATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005930.2-1662s1c1
Sequence:CCGGCAAGGGCAGATTATTTCCCATCTCGAGATGGGAAATAATCTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146034
VALIDATED
CTAGE5 MISSION shRNA Bacterial Glycerol Stock
CTAGE family, member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146034.1-2486s1c1
Sequence:CCGGGCAGTCATTTCCGTCTCATTTCTCGAGAAATGAGACGGAAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-764s1c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-2508s1c1
Sequence:CCGGCAGTTTAAGTAACTGCTGTTACTCGAGTAACAGCAGTTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-870s1c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-229s1c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-1006s1c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-1000s21c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-764s21c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-870s21c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-229s21c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146034
VALIDATED
CTAGE5 MISSION shRNA shRNA Plasmid DNA
CTAGE family, member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146034.1-2486s1c1
Sequence:CCGGGCAGTCATTTCCGTCTCATTTCTCGAGAAATGAGACGGAAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-764s1c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-2508s1c1
Sequence:CCGGCAGTTTAAGTAACTGCTGTTACTCGAGTAACAGCAGTTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-870s1c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-229s1c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-1006s1c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-1000s21c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-764s21c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-870s21c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-229s21c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146034
VALIDATED
CTAGE5 MISSION shRNA Lentiviral Transduction Particles
CTAGE family, member 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146034.1-2486s1c1
Sequence:CCGGGCAGTCATTTCCGTCTCATTTCTCGAGAAATGAGACGGAAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-764s1c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-2508s1c1
Sequence:CCGGCAGTTTAAGTAACTGCTGTTACTCGAGTAACAGCAGTTACTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-870s1c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-229s1c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146034.1-1006s1c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-1000s21c1
Sequence:CCGGGCTGATTTATGCAGCTAAGTTCTCGAGAACTTAGCTGCATAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-764s21c1
Sequence:CCGGCAAGTGAATGATCTCGATAAACTCGAGTTTATCGAGATCATTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-870s21c1
Sequence:CCGGGCCTGCTAAAGATGAAGGATTCTCGAGAATCCTTCATCTTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146034.2-229s21c1
Sequence:CCGGCCGATCAATTCGAAGCCGATTCTCGAGAATCGGCTTCGAATTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks