EMAIL THIS PAGE TO A FRIEND

CTAGE6

CTAGE family, member 6

7 Gene Product Result for
Synonyms: CTAGE6P
Species: Human CTAGE6(340307)
UniProtKB ID: Q86UF2, A4FU29, Q3ZCM5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400864 Anti-CTAGE6 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178561 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178561 Rosetta Predictions human pricing
XM_498461 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369811 predicted 2455
2 SASI_Hs02_00369812 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271588 predicted 2974
2 SASI_Hs01_00271589 predicted 2962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178561
CTAGE6 MISSION shRNA Bacterial Glycerol Stock
CTAGE family, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1396s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-215s1c1
Sequence:CCGGGTGGAGAAGTTTAGATCGGTTCTCGAGAACCGATCTAAACTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1755s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-2145s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-728s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGAGAACTCGAGTTCTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1871s1c1
Sequence:CCGGCCAGGACAATCATATCCTGATCTCGAGATCAGGATATGATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-800s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1652s1c1
Sequence:CCGGCCTCAAACTTTGTTGGAGGATCTCGAGATCCTCCAACAAAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-2004s1c1
Sequence:CCGGCAATGCCTTCAGAAATGGAATCTCGAGATTCCATTTCTGAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-527s1c1
Sequence:CCGGGATGAATTGATGGCGGATATTCTCGAGAATATCCGCCATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178561
CTAGE6 MISSION shRNA shRNA Plasmid DNA
CTAGE family, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1396s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-215s1c1
Sequence:CCGGGTGGAGAAGTTTAGATCGGTTCTCGAGAACCGATCTAAACTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1755s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-2145s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-728s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGAGAACTCGAGTTCTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1871s1c1
Sequence:CCGGCCAGGACAATCATATCCTGATCTCGAGATCAGGATATGATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-800s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1652s1c1
Sequence:CCGGCCTCAAACTTTGTTGGAGGATCTCGAGATCCTCCAACAAAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-2004s1c1
Sequence:CCGGCAATGCCTTCAGAAATGGAATCTCGAGATTCCATTTCTGAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-527s1c1
Sequence:CCGGGATGAATTGATGGCGGATATTCTCGAGAATATCCGCCATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178561
CTAGE6 MISSION shRNA Lentiviral Transduction Particles
CTAGE family, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1396s1c1
Sequence:CCGGGCAGGTTATTTCCTACGAGAACTCGAGTTCTCGTAGGAAATAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-215s1c1
Sequence:CCGGGTGGAGAAGTTTAGATCGGTTCTCGAGAACCGATCTAAACTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1755s1c1
Sequence:CCGGCCAATGAAAGAGGAGAACCAACTCGAGTTGGTTCTCCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-2145s1c1
Sequence:CCGGGACCATTGTTTCCAGTGGATACTCGAGTATCCACTGGAAACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-728s1c1
Sequence:CCGGGCTGAAGTATGGAAAGGAGAACTCGAGTTCTCCTTTCCATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-1871s1c1
Sequence:CCGGCCAGGACAATCATATCCTGATCTCGAGATCAGGATATGATTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-800s1c1
Sequence:CCGGGCAGAACAAGTTCTGAATGATCTCGAGATCATTCAGAACTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178561.3-1652s1c1
Sequence:CCGGCCTCAAACTTTGTTGGAGGATCTCGAGATCCTCCAACAAAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-2004s1c1
Sequence:CCGGCAATGCCTTCAGAAATGGAATCTCGAGATTCCATTTCTGAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178561.3-527s1c1
Sequence:CCGGGATGAATTGATGGCGGATATTCTCGAGAATATCCGCCATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks