EMAIL THIS PAGE TO A FRIEND

CTAGE9

CTAGE family, member 9

28 Gene Product Result for
Species: Human CTAGE9(643854)
UniProtKB ID: A4FU28
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_928907 Rosetta Predictions human pricing
XR_017219 Rosetta Predictions human pricing
XR_042082 Rosetta Predictions human pricing
XR_042083 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269634 predicted 2756
2 SASI_Hs01_00269635 predicted 2931
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492637 predicted 3171
2 SASI_Hs02_00492638 predicted 2084
3 SASI_Hs02_00492639 predicted 3049
4 SASI_Hs02_00492640 predicted 3512
5 SASI_Hs02_00492641 predicted 2268
6 SASI_Hs02_00492642 predicted 3092
7 SASI_Hs02_00492643 predicted 3162
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532937 predicted 2092
2 SASI_Hs02_00532938 predicted 3054
3 SASI_Hs02_00532939 predicted 2271
4 SASI_Hs02_00532940 predicted 3096
5 SASI_Hs02_00532941 predicted 3162
6 SASI_Hs02_00532942 predicted 3515
7 SASI_Hs02_00532943 predicted 3166
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532944 predicted 1578
2 SASI_Hs02_00532945 predicted 1753
3 SASI_Hs02_00532946 predicted 1257
4 SASI_Hs02_00532947 predicted 1017
5 SASI_Hs02_00532948 predicted 1374
6 SASI_Hs02_00532949 predicted 1239
7 SASI_Hs02_00532950 predicted 1526
8 SASI_Hs02_00532951 predicted 1485
9 SASI_Hs02_00532952 predicted 1097
10 SASI_Hs02_00532953 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145659
CTAGE9 MISSION shRNA Bacterial Glycerol Stock
CTAGE family, member 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145659.1-2406s21c1
Sequence:CCGGAGCAAGACACCTGACAATATTCTCGAGAATATTGTCAGGTGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-239s21c1
Sequence:CCGGCAACGCTTTCTGGACTAATTGCTCGAGCAATTAGTCCAGAAAGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-1050s21c1
Sequence:CCGGAGAGCTTACAGAGCATATTAACTCGAGTTAATATGCTCTGTAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-491s21c1
Sequence:CCGGATGAATTGATGGCGGATATTTCTCGAGAAATATCCGCCATCAATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-193s21c1
Sequence:CCGGTCGGTTAGGAGTCGGCTTTATCTCGAGATAAAGCCGACTCCTAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145659
CTAGE9 MISSION shRNA shRNA Plasmid DNA
CTAGE family, member 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145659.1-2406s21c1
Sequence:CCGGAGCAAGACACCTGACAATATTCTCGAGAATATTGTCAGGTGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-239s21c1
Sequence:CCGGCAACGCTTTCTGGACTAATTGCTCGAGCAATTAGTCCAGAAAGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-1050s21c1
Sequence:CCGGAGAGCTTACAGAGCATATTAACTCGAGTTAATATGCTCTGTAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-491s21c1
Sequence:CCGGATGAATTGATGGCGGATATTTCTCGAGAAATATCCGCCATCAATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-193s21c1
Sequence:CCGGTCGGTTAGGAGTCGGCTTTATCTCGAGATAAAGCCGACTCCTAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145659
CTAGE9 MISSION shRNA Lentiviral Transduction Particles
CTAGE family, member 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145659.1-2406s21c1
Sequence:CCGGAGCAAGACACCTGACAATATTCTCGAGAATATTGTCAGGTGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-239s21c1
Sequence:CCGGCAACGCTTTCTGGACTAATTGCTCGAGCAATTAGTCCAGAAAGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-1050s21c1
Sequence:CCGGAGAGCTTACAGAGCATATTAACTCGAGTTAATATGCTCTGTAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-491s21c1
Sequence:CCGGATGAATTGATGGCGGATATTTCTCGAGAAATATCCGCCATCAATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145659.1-193s21c1
Sequence:CCGGTCGGTTAGGAGTCGGCTTTATCTCGAGATAAAGCCGACTCCTAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)