EMAIL THIS PAGE TO A FRIEND

CTBP1-AS2

CTBP1 antisense RNA 2 (head to head)

58 Gene Product Result for
Synonyms: C4orf42 CTBP1-AS1
Species: Human CTBP1-AS2(92070)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052861 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038381 MISSION® esiRNA esiRNA human C4orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052861 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222333 predicted 464
2 SASI_Hs01_00222334 predicted 377
3 SASI_Hs01_00222335 predicted 719
4 SASI_Hs01_00222336 predicted 1201
5 SASI_Hs01_00222337 predicted 719
6 SASI_Hs01_00222338 predicted 727
7 SASI_Hs01_00222339 predicted 348
8 SASI_Hs01_00222340 predicted 457
9 SASI_Hs01_00222341 predicted 700
10 SASI_Hs01_00222342 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052861
CTBP1-AS2 MISSION shRNA Bacterial Glycerol Stock
CTBP1 antisense RNA 2 (head to head)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-465s1c1
Sequence:CCGGCTGAGTGTCCAGCAAACATCACTCGAGTGATGTTTGCTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-352s1c1
Sequence:CCGGGCAGCAAGTCAGGTTGTGATTCTCGAGAATCACAACCTGACTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-535s1c1
Sequence:CCGGGTCCAGAAGAACAGTTCCTCTCTCGAGAGAGGAACTGTTCTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-356s1c1
Sequence:CCGGCAAGTCAGGTTGTGATTTACTCTCGAGAGTAAATCACAACCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-476s1c1
Sequence:CCGGGCAAACATCACATAAGGCTTTCTCGAGAAAGCCTTATGTGATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052861.2-1389s1c1
Sequence:CCGGCGTGTGAAAGAAGAACTCCAACTCGAGTTGGAGTTCTTCTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-385s1c1
Sequence:CCGGGTGAATATAATGGAGAGACTTCTCGAGAAGTCTCTCCATTATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-530s1c1
Sequence:CCGGGCTCAGTCCAGAAGAACAGTTCTCGAGAACTGTTCTTCTGGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052861
CTBP1-AS2 MISSION shRNA shRNA Plasmid DNA
CTBP1 antisense RNA 2 (head to head)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-465s1c1
Sequence:CCGGCTGAGTGTCCAGCAAACATCACTCGAGTGATGTTTGCTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-352s1c1
Sequence:CCGGGCAGCAAGTCAGGTTGTGATTCTCGAGAATCACAACCTGACTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-535s1c1
Sequence:CCGGGTCCAGAAGAACAGTTCCTCTCTCGAGAGAGGAACTGTTCTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-356s1c1
Sequence:CCGGCAAGTCAGGTTGTGATTTACTCTCGAGAGTAAATCACAACCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-476s1c1
Sequence:CCGGGCAAACATCACATAAGGCTTTCTCGAGAAAGCCTTATGTGATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052861.2-1389s1c1
Sequence:CCGGCGTGTGAAAGAAGAACTCCAACTCGAGTTGGAGTTCTTCTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-385s1c1
Sequence:CCGGGTGAATATAATGGAGAGACTTCTCGAGAAGTCTCTCCATTATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-530s1c1
Sequence:CCGGGCTCAGTCCAGAAGAACAGTTCTCGAGAACTGTTCTTCTGGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052861
CTBP1-AS2 MISSION shRNA Lentiviral Transduction Particles
CTBP1 antisense RNA 2 (head to head)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-465s1c1
Sequence:CCGGCTGAGTGTCCAGCAAACATCACTCGAGTGATGTTTGCTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-352s1c1
Sequence:CCGGGCAGCAAGTCAGGTTGTGATTCTCGAGAATCACAACCTGACTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-535s1c1
Sequence:CCGGGTCCAGAAGAACAGTTCCTCTCTCGAGAGAGGAACTGTTCTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-356s1c1
Sequence:CCGGCAAGTCAGGTTGTGATTTACTCTCGAGAGTAAATCACAACCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-476s1c1
Sequence:CCGGGCAAACATCACATAAGGCTTTCTCGAGAAAGCCTTATGTGATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052861.2-1389s1c1
Sequence:CCGGCGTGTGAAAGAAGAACTCCAACTCGAGTTGGAGTTCTTCTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-385s1c1
Sequence:CCGGGTGAATATAATGGAGAGACTTCTCGAGAAGTCTCTCCATTATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052861.2-530s1c1
Sequence:CCGGGCTCAGTCCAGAAGAACAGTTCTCGAGAACTGTTCTTCTGGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks