EMAIL THIS PAGE TO A FRIEND

CTBP1

C-terminal binding protein 1

Synonyms: BARS
UniProtKB ID: Q13363, Q4W5N3, Q7Z2Q5
Gene ID:
Human(1487) Summary: This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(13016) C-terminal binding protein 1
Rat(29382) C-terminal binding protein 1
Zebrafish(65229) C-terminal binding protein 1
cow(513131) C-terminal binding protein 1
Horse(100052216) C-terminal binding protein 1
domestic cat(101095494) C-terminal binding protein 1
dog(612240) C-terminal binding protein 1
chicken(422904) C-terminal binding protein 1
naked mole-rat(101720982) C-terminal binding protein 1
domestic guinea pig(100730806) C-terminal binding protein 1
Gene Class: Dehydrogenase
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018987 Anti-CTBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV32468 Anti-CTBP1 antibody produced in rabbit affinity isolated antibody horse, rat, mouse, human,
immunohistochemistry, western blot pricing
SAB1410257 Anti-CTBP1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
C8741 Anti-CtBP1, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
immunoprecipitation, microarray, western blot pricing
C9491 Anti-CtBP1, N-terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunoprecipitation, microarray, western blot pricing
SAB4504699 Anti-phospho-CtBP1 (pSer422) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301354 Anti-phospho-CtBP1 (pSer422) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
WH0001487M1 Monoclonal Anti-CTBP1 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0091 Rabbit anti-CTBP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gibbon, rhesus monkey, primate, rat, human, chimpanzee, marmoset, guinea pig
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012614 Rosetta Predictions human pricing
NM_001328 Rosetta Predictions human pricing
NM_019201 Rosetta Predictions rat pricing
NM_013502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306193 predicted 1390
2 SASI_Hs01_00243819 predicted 738
3 SASI_Hs01_00243820 predicted 949
4 SASI_Hs01_00243821 predicted 1110
5 SASI_Hs01_00243822 predicted 1720
6 SASI_Hs01_00243823 predicted 1628
7 SASI_Hs01_00243824 predicted 1066
8 SASI_Hs01_00243825 predicted 1238
9 SASI_Hs02_00306194 predicted 1648
10 SASI_Hs02_00306195 predicted 1226
11 SASI_Hs01_00243826 predicted 1747
12 SASI_Hs01_00243827 predicted 1256
13 SASI_Hs01_00243828 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331633 predicted 1196
2 SASI_Hs01_00129156 predicted 545
3 SASI_Hs01_00129157 predicted 748
4 SASI_Hs01_00129158 predicted 910
5 SASI_Hs01_00129159 predicted 1521
6 SASI_Hs01_00129160 predicted 1439
7 SASI_Hs01_00129161 predicted 873
8 SASI_Hs01_00129162 predicted 1041
9 SASI_Hs02_00331634 predicted 1456
10 SASI_Hs02_00331635 predicted 1026
11 SASI_Hs01_00129163 predicted 1552
12 SASI_Hs01_00129164 predicted 1056
13 SASI_Hs01_00129165 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262030 predicted 934
2 SASI_Rn01_00043684 predicted 1239
3 SASI_Rn01_00043685 predicted 652
4 SASI_Rn01_00043686 predicted 671
5 SASI_Rn01_00043687 predicted 623
6 SASI_Rn02_00262031 predicted 611
7 SASI_Rn01_00043688 predicted 1099
8 SASI_Rn01_00043689 predicted 778
9 SASI_Rn01_00043690 predicted 953
10 SASI_Rn01_00043691 predicted 1628
11 SASI_Rn01_00043692 predicted 1653
12 SASI_Rn01_00043693 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071058 predicted 1042
2 SASI_Mm01_00071060 predicted 747
3 SASI_Mm01_00071061 predicted 618
4 SASI_Mm01_00071062 predicted 408
5 SASI_Mm01_00071064 predicted 396
6 SASI_Mm01_00071065 predicted 1042
7 SASI_Mm01_00071066 predicted 424
8 SASI_Mm01_00071067 predicted 1426
9 SASI_Mm02_00322157 predicted 1443
10 SASI_Mm02_00322158 predicted 433
11 SASI_Mm01_00071059 predicted 738
12 SASI_Mm01_00071063 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013502
VALIDATED
CTBP1 MISSION shRNA Bacterial Glycerol Stock
C-terminal binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-400s21c1
Sequence:CCGGAGAAGATCTGGAGAAGTTTAACTCGAGTTAAACTTCTCCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-882s21c1
Sequence:CCGGACCACCTCATCAATGACTTTACTCGAGTAAAGTCATTGATGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-672s21c1
Sequence:CCGGGAGAGACCTTGGGCATCATTGCTCGAGCAATGATGCCCAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013502.2-1676s21c1
Sequence:CCGGTCCTTTGCGTTCCTCGTTTAACTCGAGTTAAACGAGGAACGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1713s1c1
Sequence:CCGGGCTAATTCTATCACGAATGTTCTCGAGAACATTCGTGATAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-422s1c1
Sequence:CCGGGCTCTTAGAATCATCGTCCGACTCGAGTCGGACGATGATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-748s1c1
Sequence:CCGGCGTCCTCTTCTATGATCCATACTCGAGTATGGATCATAGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-451s1c1
Sequence:CCGGCGGGTTTGACAATATCGACATCTCGAGATGTCGATATTGTCAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1456s1c1
Sequence:CCGGCCATACGAGTGACCAGTTGTACTCGAGTACAACTGGTCACTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013502
VALIDATED
CTBP1 MISSION shRNA shRNA Plasmid DNA
C-terminal binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-400s21c1
Sequence:CCGGAGAAGATCTGGAGAAGTTTAACTCGAGTTAAACTTCTCCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-882s21c1
Sequence:CCGGACCACCTCATCAATGACTTTACTCGAGTAAAGTCATTGATGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-672s21c1
Sequence:CCGGGAGAGACCTTGGGCATCATTGCTCGAGCAATGATGCCCAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013502.2-1676s21c1
Sequence:CCGGTCCTTTGCGTTCCTCGTTTAACTCGAGTTAAACGAGGAACGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1713s1c1
Sequence:CCGGGCTAATTCTATCACGAATGTTCTCGAGAACATTCGTGATAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-422s1c1
Sequence:CCGGGCTCTTAGAATCATCGTCCGACTCGAGTCGGACGATGATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-748s1c1
Sequence:CCGGCGTCCTCTTCTATGATCCATACTCGAGTATGGATCATAGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-451s1c1
Sequence:CCGGCGGGTTTGACAATATCGACATCTCGAGATGTCGATATTGTCAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1456s1c1
Sequence:CCGGCCATACGAGTGACCAGTTGTACTCGAGTACAACTGGTCACTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013502
VALIDATED
CTBP1 MISSION shRNA Lentiviral Transduction Particles
C-terminal binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-400s21c1
Sequence:CCGGAGAAGATCTGGAGAAGTTTAACTCGAGTTAAACTTCTCCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-882s21c1
Sequence:CCGGACCACCTCATCAATGACTTTACTCGAGTAAAGTCATTGATGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013502.2-672s21c1
Sequence:CCGGGAGAGACCTTGGGCATCATTGCTCGAGCAATGATGCCCAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013502.2-1676s21c1
Sequence:CCGGTCCTTTGCGTTCCTCGTTTAACTCGAGTTAAACGAGGAACGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1713s1c1
Sequence:CCGGGCTAATTCTATCACGAATGTTCTCGAGAACATTCGTGATAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-422s1c1
Sequence:CCGGGCTCTTAGAATCATCGTCCGACTCGAGTCGGACGATGATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-748s1c1
Sequence:CCGGCGTCCTCTTCTATGATCCATACTCGAGTATGGATCATAGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-451s1c1
Sequence:CCGGCGGGTTTGACAATATCGACATCTCGAGATGTCGATATTGTCAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013502.1-1456s1c1
Sequence:CCGGCCATACGAGTGACCAGTTGTACTCGAGTACAACTGGTCACTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001328
VALIDATED
CTBP1 MISSION shRNA Bacterial Glycerol Stock
C-terminal binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1703s21c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-916s21c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001328.2-469s21c1
Sequence:CCGGTTTGACAACATCGACATCAAGCTCGAGCTTGATGTCGATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1467s21c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1043s21c1
Sequence:CCGGAGTCGGAACCCTTCAGCTTTACTCGAGTAAAGCTGAAGGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1583s1c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-800s1c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-1009s1c1
Sequence:CCGGCGAGCAGGCATCCATCGAGATCTCGAGATCTCGATGGATGCCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1351s1c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-323s1c1
Sequence:CCGGCTCCGCATCATCGTCCGGATTCTCGAGAATCCGGACGATGATGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001328
VALIDATED
CTBP1 MISSION shRNA shRNA Plasmid DNA
C-terminal binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1703s21c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-916s21c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001328.2-469s21c1
Sequence:CCGGTTTGACAACATCGACATCAAGCTCGAGCTTGATGTCGATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1467s21c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1043s21c1
Sequence:CCGGAGTCGGAACCCTTCAGCTTTACTCGAGTAAAGCTGAAGGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1583s1c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-800s1c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-1009s1c1
Sequence:CCGGCGAGCAGGCATCCATCGAGATCTCGAGATCTCGATGGATGCCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1351s1c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-323s1c1
Sequence:CCGGCTCCGCATCATCGTCCGGATTCTCGAGAATCCGGACGATGATGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001328
VALIDATED
CTBP1 MISSION shRNA Lentiviral Transduction Particles
C-terminal binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1703s21c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-916s21c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001328.2-469s21c1
Sequence:CCGGTTTGACAACATCGACATCAAGCTCGAGCTTGATGTCGATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1467s21c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001328.2-1043s21c1
Sequence:CCGGAGTCGGAACCCTTCAGCTTTACTCGAGTAAAGCTGAAGGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1583s1c1
Sequence:CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-800s1c1
Sequence:CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-1009s1c1
Sequence:CCGGCGAGCAGGCATCCATCGAGATCTCGAGATCTCGATGGATGCCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001328.1-1351s1c1
Sequence:CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001328.1-323s1c1
Sequence:CCGGCTCCGCATCATCGTCCGGATTCTCGAGAATCCGGACGATGATGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks