EMAIL THIS PAGE TO A FRIEND

CTBP2

C-terminal binding protein 2

117 Gene Product Result for
Gene ID:
Human(1488) Summary: This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. [provided by RefSeq, Jul 2008]
Mouse(13017) C-terminal binding protein 2
Rat(81717) C-terminal binding protein 2
Zebrafish(65230) C-terminal binding protein 2
domestic cat(101099152) C-terminal binding protein 2
cow(281730) C-terminal binding protein 2
Horse(100056830) C-terminal binding protein 2
dog(100684514) C-terminal binding protein 2
chicken(423958) C-terminal binding protein 2
Goat(100861356) C-terminal binding protein 2
Domestic Rabbit(100344790) C-terminal binding protein 2
sheep(101115416) C-terminal binding protein 2
domestic guinea pig(100734125) C-terminal binding protein 2
naked mole-rat(101703892) C-terminal binding protein 2
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083914 Rosetta Predictions human pricing
NM_001329 Rosetta Predictions human pricing
NM_022802 Rosetta Predictions human pricing
NM_053335 Rosetta Predictions rat pricing
NM_009980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317301 predicted 1034
2 SASI_Hs02_00317302 predicted 1183
3 SASI_Hs02_00317303 predicted 744
4 SASI_Hs02_00317304 predicted 980
5 SASI_Hs02_00317305 predicted 1789
6 SASI_Hs02_00317306 predicted 786
7 SASI_Hs02_00317307 predicted 1579
8 SASI_Hs02_00317308 predicted 835
9 SASI_Hs02_00317309 predicted 1570
10 SASI_Hs02_00317310 predicted 1859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193146 predicted 1022
2 SASI_Hs01_00193148 predicted 1173
3 SASI_Hs01_00193154 predicted 733
4 SASI_Hs01_00193150 predicted 968
5 SASI_Hs01_00193151 predicted 1783
6 SASI_Hs02_00331636 predicted 773
7 SASI_Hs01_00193152 predicted 1560
8 SASI_Hs01_00193153 predicted 822
9 SASI_Hs01_00193145 predicted 1558
10 SASI_Hs01_00193147 predicted 1840
11 SASI_Hs01_00193149 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075980 predicted 2344
2 SASI_Hs01_00075982 predicted 2497
3 SASI_Hs02_00356099 predicted 2061
4 SASI_Hs01_00075984 predicted 2293
5 SASI_Hs01_00075985 predicted 3104
6 SASI_Hs02_00356100 predicted 2097
7 SASI_Hs01_00075986 predicted 2885
8 SASI_Hs02_00356101 predicted 2146
9 SASI_Hs01_00075979 predicted 2882
10 SASI_Hs01_00075981 predicted 3166
11 SASI_Hs01_00075983 predicted 3109
12 SASI_Hs01_00075987 predicted 1568
13 SASI_Hs01_00075988 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117265 predicted 626
2 SASI_Rn01_00117266 predicted 2285
3 SASI_Rn01_00117267 predicted 3119
4 SASI_Rn01_00117268 predicted 3020
5 SASI_Rn01_00117269 predicted 2790
6 SASI_Rn01_00117270 predicted 813
7 SASI_Rn01_00117271 predicted 1704
8 SASI_Rn01_00117272 predicted 1528
9 SASI_Rn02_00265795 predicted 3037
10 SASI_Rn01_00117273 predicted 3113
11 SASI_Rn01_00117274 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040091 predicted 1976
2 SASI_Mm01_00040092 predicted 953
3 SASI_Mm01_00040093 predicted 1178
4 SASI_Mm01_00040094 predicted 1144
5 SASI_Mm02_00317572 predicted 1557
6 SASI_Mm01_00040095 predicted 1096
7 SASI_Mm01_00040096 predicted 1514
8 SASI_Mm01_00040097 predicted 579
9 SASI_Mm01_00040098 predicted 1906
10 SASI_Mm02_00317573 predicted 1473
11 SASI_Mm01_00040099 predicted 1568
12 SASI_Mm01_00040100 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001329
VALIDATED
CTBP2 MISSION shRNA Bacterial Glycerol Stock
C-terminal binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001329.1-2190s1c1
Sequence:CCGGCGCATAGGATTGAAGACAGTACTCGAGTACTGTCTTCAATCCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-636s1c1
Sequence:CCGGCCTGAGAGTGATCGTGCGGATCTCGAGATCCGCACGATCACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-386s1c1
Sequence:CCGGTGGACAGAATTTGTGAAGGTACTCGAGTACCTTCACAAATTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-1069s1c1
Sequence:CCGGCACTGCAATCTCAACGAACATCTCGAGATGTTCGTTGAGATTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001329.1-946s1c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001329.2-1931s21c1
Sequence:CCGGTGCTTACGGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCCGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1462s21c1
Sequence:CCGGTCGCATCCCAGAAAGCTTAAGCTCGAGCTTAAGCTTTCTGGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1022s21c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1178s21c1
Sequence:CCGGATCAATGACTTTACCATAAAGCTCGAGCTTTATGGTAAAGTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1513s21c1
Sequence:CCGGATCAGCGCCTTGGTCAGTAATCTCGAGATTACTGACCAAGGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001329
VALIDATED
CTBP2 MISSION shRNA shRNA Plasmid DNA
C-terminal binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001329.1-2190s1c1
Sequence:CCGGCGCATAGGATTGAAGACAGTACTCGAGTACTGTCTTCAATCCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-636s1c1
Sequence:CCGGCCTGAGAGTGATCGTGCGGATCTCGAGATCCGCACGATCACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-386s1c1
Sequence:CCGGTGGACAGAATTTGTGAAGGTACTCGAGTACCTTCACAAATTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-1069s1c1
Sequence:CCGGCACTGCAATCTCAACGAACATCTCGAGATGTTCGTTGAGATTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001329.1-946s1c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001329.2-1931s21c1
Sequence:CCGGTGCTTACGGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCCGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1462s21c1
Sequence:CCGGTCGCATCCCAGAAAGCTTAAGCTCGAGCTTAAGCTTTCTGGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1022s21c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1178s21c1
Sequence:CCGGATCAATGACTTTACCATAAAGCTCGAGCTTTATGGTAAAGTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1513s21c1
Sequence:CCGGATCAGCGCCTTGGTCAGTAATCTCGAGATTACTGACCAAGGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001329
VALIDATED
CTBP2 MISSION shRNA Lentiviral Transduction Particles
C-terminal binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001329.1-2190s1c1
Sequence:CCGGCGCATAGGATTGAAGACAGTACTCGAGTACTGTCTTCAATCCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-636s1c1
Sequence:CCGGCCTGAGAGTGATCGTGCGGATCTCGAGATCCGCACGATCACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-386s1c1
Sequence:CCGGTGGACAGAATTTGTGAAGGTACTCGAGTACCTTCACAAATTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001329.1-1069s1c1
Sequence:CCGGCACTGCAATCTCAACGAACATCTCGAGATGTTCGTTGAGATTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001329.1-946s1c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001329.2-1931s21c1
Sequence:CCGGTGCTTACGGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCCGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1462s21c1
Sequence:CCGGTCGCATCCCAGAAAGCTTAAGCTCGAGCTTAAGCTTTCTGGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1022s21c1
Sequence:CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1178s21c1
Sequence:CCGGATCAATGACTTTACCATAAAGCTCGAGCTTTATGGTAAAGTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001329.2-1513s21c1
Sequence:CCGGATCAGCGCCTTGGTCAGTAATCTCGAGATTACTGACCAAGGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009980
VALIDATED
CTBP2 MISSION shRNA Bacterial Glycerol Stock
C-terminal binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1016s1c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1045s1c1
Sequence:CCGGCCCTACTTACAGGATGGGATACTCGAGTATCCCATCCTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1339s1c1
Sequence:CCGGCCATTGAAGGATGCTCCAAATCTCGAGATTTGGAGCATCCTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1807s1c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009980.2-1264s1c1
Sequence:CCGGGCCCTCAAGGAGGGCAGGATACTCGAGTATCCTGCCCTCCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1607s21c1
Sequence:CCGGTACGAAACTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGTTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1151s21c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009980.4-1942s21c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-956s21c1
Sequence:CCGGATTCGACAGTCTGCCACATTCCTCGAGGAATGTGGCAGACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1232s21c1
Sequence:CCGGCCCTGCAGGACTTGCTATATCCTCGAGGATATAGCAAGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009980
VALIDATED
CTBP2 MISSION shRNA shRNA Plasmid DNA
C-terminal binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1016s1c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1045s1c1
Sequence:CCGGCCCTACTTACAGGATGGGATACTCGAGTATCCCATCCTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1339s1c1
Sequence:CCGGCCATTGAAGGATGCTCCAAATCTCGAGATTTGGAGCATCCTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1807s1c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009980.2-1264s1c1
Sequence:CCGGGCCCTCAAGGAGGGCAGGATACTCGAGTATCCTGCCCTCCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1607s21c1
Sequence:CCGGTACGAAACTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGTTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1151s21c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009980.4-1942s21c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-956s21c1
Sequence:CCGGATTCGACAGTCTGCCACATTCCTCGAGGAATGTGGCAGACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1232s21c1
Sequence:CCGGCCCTGCAGGACTTGCTATATCCTCGAGGATATAGCAAGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009980
VALIDATED
CTBP2 MISSION shRNA Lentiviral Transduction Particles
C-terminal binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1016s1c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1045s1c1
Sequence:CCGGCCCTACTTACAGGATGGGATACTCGAGTATCCCATCCTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1339s1c1
Sequence:CCGGCCATTGAAGGATGCTCCAAATCTCGAGATTTGGAGCATCCTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009980.2-1807s1c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009980.2-1264s1c1
Sequence:CCGGGCCCTCAAGGAGGGCAGGATACTCGAGTATCCTGCCCTCCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1607s21c1
Sequence:CCGGTACGAAACTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGTTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1151s21c1
Sequence:CCGGCCTTTGGATTCAGCGTCATATCTCGAGATATGACGCTGAATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009980.4-1942s21c1
Sequence:CCGGCGGATGAATTTGATGGTCTTTCTCGAGAAAGACCATCAAATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-956s21c1
Sequence:CCGGATTCGACAGTCTGCCACATTCCTCGAGGAATGTGGCAGACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009980.4-1232s21c1
Sequence:CCGGCCCTGCAGGACTTGCTATATCCTCGAGGATATAGCAAGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks