EMAIL THIS PAGE TO A FRIEND

CTC1

CTS telomere maintenance complex component 1

60 Gene Product Result for
Synonyms: AAF-132 AAF132 C17orf68 CRMCC tmp494178
Gene ID:
Human(80169) Summary: This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
Mouse(68964) CTS telomere maintenance complex component 1
Rat(303238) CTS telomere maintenance complex component 1
sheep(101122709) CTS telomere maintenance complex component 1
domestic guinea pig(100729792) CTS telomere maintenance complex component 1
naked mole-rat(101714323) CTS telomere maintenance complex component 1
Zebrafish(777638) CTS telomere maintenance complex component 1
cow(513500) CTS telomere maintenance complex component 1
Horse(100073051) CTS telomere maintenance complex component 1
domestic cat(101080587) CTS telomere maintenance complex component 1
dog(479493) CTS telomere maintenance complex component 1
Thale Cress(826554) CST complex subunit CTC1
chicken(418324) CTS telomere maintenance complex component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025099 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001143790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001143790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001143790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025099 Rosetta Predictions human pricing
NM_001107010 Rosetta Predictions rat pricing
NM_001013256 Rosetta Predictions mouse pricing
NM_026889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180981 predicted 3016
2 SASI_Hs01_00180982 predicted 750
3 SASI_Hs01_00180984 predicted 3699
4 SASI_Hs01_00180985 predicted 3550
5 SASI_Hs02_00357796 predicted 240
6 SASI_Hs01_00180986 predicted 2846
7 SASI_Hs01_00180988 predicted 1076
8 SASI_Hs01_00180989 predicted 2016
9 SASI_Hs01_00180990 predicted 3779
10 SASI_Hs02_00357797 predicted 697
11 SASI_Hs01_00180983 predicted 982
12 SASI_Hs01_00180987 predicted 2510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224596 predicted 1844
2 SASI_Rn02_00224597 predicted 1603
3 SASI_Rn02_00224598 predicted 2987
4 SASI_Rn02_00224599 predicted 2691
5 SASI_Rn02_00224600 predicted 1578
6 SASI_Rn02_00224601 predicted 3677
7 SASI_Rn02_00224602 predicted 561
8 SASI_Rn02_00224603 predicted 2794
9 SASI_Rn02_00224604 predicted 3283
10 SASI_Rn02_00224605 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176219 predicted 2778
2 SASI_Mm01_00176220 predicted 1373
3 SASI_Mm01_00176221 predicted 870
4 SASI_Mm01_00176222 predicted 1366
5 SASI_Mm01_00176223 predicted 1334
6 SASI_Mm01_00176224 predicted 1062
7 SASI_Mm01_00176225 predicted 3070
8 SASI_Mm01_00176226 predicted 929
9 SASI_Mm01_00176227 predicted 1344
10 SASI_Mm01_00176228 predicted 3359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141150 predicted 719
2 SASI_Mm01_00141151 predicted 2794
3 SASI_Mm01_00141152 predicted 1389
4 SASI_Mm01_00141153 predicted 895
5 SASI_Mm01_00141154 predicted 1379
6 SASI_Mm01_00141155 predicted 1344
7 SASI_Mm01_00141156 predicted 1073
8 SASI_Mm01_00141157 predicted 3085
9 SASI_Mm01_00141158 predicted 949
10 SASI_Mm01_00141159 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026889
VALIDATED
CTC1 MISSION shRNA Bacterial Glycerol Stock
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2187s1c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2419s1c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-3764s1c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026889.1-3711s1c1
Sequence:CCGGCCACTGTGATTTCTAGTTATTCTCGAGAATAACTAGAAATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2927s1c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026889
VALIDATED
CTC1 MISSION shRNA shRNA Plasmid DNA
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2187s1c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2419s1c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-3764s1c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026889.1-3711s1c1
Sequence:CCGGCCACTGTGATTTCTAGTTATTCTCGAGAATAACTAGAAATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2927s1c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026889
VALIDATED
CTC1 MISSION shRNA Lentiviral Transduction Particles
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2187s1c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2419s1c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-3764s1c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026889.1-3711s1c1
Sequence:CCGGCCACTGTGATTTCTAGTTATTCTCGAGAATAACTAGAAATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026889.1-2927s1c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025099
VALIDATED
CTC1 MISSION shRNA Bacterial Glycerol Stock
CTS telomere maintenance complex component 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-1658s1c1
Sequence:CCGGCCGTCCTATTGTGCTTTCTTTCTCGAGAAAGAAAGCACAATAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-875s1c1
Sequence:CCGGCACAGATTCCTTGGTGTCTTTCTCGAGAAAGACACCAAGGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-561s1c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-579s1c1
Sequence:CCGGGATCAGAAGGTTCACCTCATTCTCGAGAATGAGGTGAACCTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-2418s21c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-3013s21c1
Sequence:CCGGGTTTCCGGTCATCCACTTATGCTCGAGCATAAGTGGATGACCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-3245s21c1
Sequence:CCGGCCCTACGCAGACAGCTATAAGCTCGAGCTTATAGCTGTCTGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-2276s21c1
Sequence:CCGGGGCCCTCATGAAGCGTAATTTCTCGAGAAATTACGCTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025099.5-3898s21c1
Sequence:CCGGGGAAATCATGGCCCTATTAATCTCGAGATTAATAGGGCCATGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025099
VALIDATED
CTC1 MISSION shRNA shRNA Plasmid DNA
CTS telomere maintenance complex component 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-1658s1c1
Sequence:CCGGCCGTCCTATTGTGCTTTCTTTCTCGAGAAAGAAAGCACAATAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-875s1c1
Sequence:CCGGCACAGATTCCTTGGTGTCTTTCTCGAGAAAGACACCAAGGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-561s1c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-579s1c1
Sequence:CCGGGATCAGAAGGTTCACCTCATTCTCGAGAATGAGGTGAACCTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-2418s21c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-3013s21c1
Sequence:CCGGGTTTCCGGTCATCCACTTATGCTCGAGCATAAGTGGATGACCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-3245s21c1
Sequence:CCGGCCCTACGCAGACAGCTATAAGCTCGAGCTTATAGCTGTCTGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-2276s21c1
Sequence:CCGGGGCCCTCATGAAGCGTAATTTCTCGAGAAATTACGCTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025099.5-3898s21c1
Sequence:CCGGGGAAATCATGGCCCTATTAATCTCGAGATTAATAGGGCCATGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025099
VALIDATED
CTC1 MISSION shRNA Lentiviral Transduction Particles
CTS telomere maintenance complex component 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-1658s1c1
Sequence:CCGGCCGTCCTATTGTGCTTTCTTTCTCGAGAAAGAAAGCACAATAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-875s1c1
Sequence:CCGGCACAGATTCCTTGGTGTCTTTCTCGAGAAAGACACCAAGGAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-561s1c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025099.1-579s1c1
Sequence:CCGGGATCAGAAGGTTCACCTCATTCTCGAGAATGAGGTGAACCTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-2418s21c1
Sequence:CCGGCAGGGAAATGACGACAATGATCTCGAGATCATTGTCGTCATTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-3013s21c1
Sequence:CCGGGTTTCCGGTCATCCACTTATGCTCGAGCATAAGTGGATGACCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025099.5-3245s21c1
Sequence:CCGGCCCTACGCAGACAGCTATAAGCTCGAGCTTATAGCTGTCTGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025099.5-2276s21c1
Sequence:CCGGGGCCCTCATGAAGCGTAATTTCTCGAGAAATTACGCTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025099.5-3898s21c1
Sequence:CCGGGGAAATCATGGCCCTATTAATCTCGAGATTAATAGGGCCATGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143790
CTC1 MISSION shRNA Bacterial Glycerol Stock
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2632s21c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-3140s21c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2400s21c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143790.1-3977s21c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2424s21c1
Sequence:CCGGGGCCCTCATGAAACGTAATTTCTCGAGAAATTACGTTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143790
CTC1 MISSION shRNA shRNA Plasmid DNA
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2632s21c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-3140s21c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2400s21c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143790.1-3977s21c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2424s21c1
Sequence:CCGGGGCCCTCATGAAACGTAATTTCTCGAGAAATTACGTTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143790
CTC1 MISSION shRNA Lentiviral Transduction Particles
CTS telomere maintenance complex component 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2632s21c1
Sequence:CCGGCCGTTCTTGTACCCAAACCAACTCGAGTTGGTTTGGGTACAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-3140s21c1
Sequence:CCGGCCAACATTGTTTACTGTTGTTCTCGAGAACAACAGTAAACAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2400s21c1
Sequence:CCGGGCTGTTCTTACTGTCCCACAACTCGAGTTGTGGGACAGTAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143790.1-3977s21c1
Sequence:CCGGCGGCAGATCACAGCATGATAACTCGAGTTATCATGCTGTGATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143790.1-2424s21c1
Sequence:CCGGGGCCCTCATGAAACGTAATTTCTCGAGAAATTACGTTTCATGAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks