EMAIL THIS PAGE TO A FRIEND

CTCF

CCCTC-binding factor (zinc finger protein)

164 Gene Product Result for
UniProtKB ID: P49711, B5MC38, Q53XI7, Q59EL8
Gene ID:
Human(10664) Summary: This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(13018) CCCTC-binding factor
Rat(83726) CCCTC-binding factor (zinc finger protein)
Zebrafish(415104) CCCTC-binding factor (zinc finger protein)
fruit fly(38817) CG8591 gene product from transcript CG8591-RA
dog(479684) CCCTC-binding factor (zinc finger protein)
cow(517097) CCCTC-binding factor (zinc finger protein)
Horse(100053363) CCCTC-binding factor (zinc finger protein)
domestic cat(101101354) CCCTC-binding factor (zinc finger protein)
chicken(396274) CCCTC-binding factor (zinc finger protein)
naked mole-rat(101709585) CCCTC-binding factor (zinc finger protein)
domestic guinea pig(100732580) CCCTC-binding factor (zinc finger protein)
sheep(101114297) CCCTC-binding factor (zinc finger protein)
Domestic Rabbit(100350641) CCCTC-binding factor (zinc finger protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C5495 Anti-CTCF (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C5620 Anti-CTCF (658-670) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV38820 Anti-CTCF (AB1) antibody produced in rabbit affinity isolated antibody mouse, bovine, human, rabbit, rat, canine, guinea pig, horse
western blot pricing
AV100757 Anti-CTCF (AB2) antibody produced in rabbit affinity isolated antibody horse, rabbit, human, rat, mouse, bovine, canine
western blot pricing
HPA004122 Anti-CTCF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AMAB90666 Monoclonal Anti-CTCF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0307, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90664 Monoclonal Anti-CTCF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0305, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90663 Monoclonal Anti-CTCF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0304, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300120 Monoclonal Anti-CTCF antibody produced in mouse clone 1D11, ascites fluid monkey, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006565 Rosetta Predictions human pricing
NM_031824 Rosetta Predictions rat pricing
NM_007794 Rosetta Predictions mouse pricing
NM_181322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230809 predicted 1669
2 SASI_Hs02_00341836 predicted 1523
3 SASI_Hs01_00230810 predicted 1735
4 SASI_Hs01_00230811 predicted 1868
5 SASI_Hs01_00230812 predicted 563
6 SASI_Hs01_00230813 predicted 2086
7 SASI_Hs01_00230815 predicted 560
8 SASI_Hs01_00230816 predicted 1355
9 SASI_Hs01_00230817 predicted 1682
10 SASI_Hs01_00230818 predicted 2286
11 SASI_Hs01_00230814 predicted 2054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100578 predicted 1549
2 SASI_Rn01_00100579 predicted 1410
3 SASI_Rn01_00100580 predicted 1750
4 SASI_Rn01_00100581 predicted 2227
5 SASI_Rn02_00265298 predicted 1792
6 SASI_Rn01_00100582 predicted 1512
7 SASI_Rn01_00100584 predicted 1659
8 SASI_Rn01_00100585 predicted 1199
9 SASI_Rn01_00100586 predicted 372
10 SASI_Rn01_00100587 predicted 1191
11 SASI_Rn01_00100583 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196207 predicted 1297
2 SASI_Mm01_00196208 predicted 1737
3 SASI_Mm01_00196209 predicted 1888
4 SASI_Mm01_00196210 predicted 1550
5 SASI_Mm01_00196211 predicted 1943
6 SASI_Mm01_00196212 predicted 681
7 SASI_Mm01_00196213 predicted 1927
8 SASI_Mm01_00196214 predicted 1283
9 SASI_Mm01_00196215 predicted 1807
10 SASI_Mm01_00196216 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097364 predicted 1288
2 SASI_Mm02_00349674 predicted 337
3 SASI_Mm01_00097365 predicted 1735
4 SASI_Mm01_00097366 predicted 1890
5 SASI_Mm02_00349675 predicted 588
6 SASI_Mm01_00097367 predicted 1544
7 SASI_Mm01_00097368 predicted 1934
8 SASI_Mm01_00097369 predicted 682
9 SASI_Mm01_00097370 predicted 1922
10 SASI_Mm02_00349676 predicted 2334
11 SASI_Mm01_00097371 predicted 1252
12 SASI_Mm01_00097372 predicted 1770
13 SASI_Mm01_00097373 predicted 1967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181322
VALIDATED
CTCF MISSION shRNA Bacterial Glycerol Stock
CCCTC-binding factor (zinc finger protein)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-752s21c1
Sequence:CCGGCAGAAAGTGAACCGATGATATCTCGAGATATCATCGGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2991s21c1
Sequence:CCGGTGGCATGCTACGATCAGTTTCCTCGAGGAAACTGATCGTAGCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1677s21c1
Sequence:CCGGGCGAAAGCAGCATTCCTATATCTCGAGATATAGGAATGCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1013s21c1
Sequence:CCGGGACTGCTGTCTGAGGTTAATGCTCGAGCATTAACCTCAGACAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-2371s21c1
Sequence:CCGGGGTGCAATTGAGAACATTATACTCGAGTATAATGTTCTCAATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-578s21c1
Sequence:CCGGTGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2601s21c1
Sequence:CCGGGGCTTTGGGAACGGCATAATTCTCGAGAATTATGCCGTTCCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1318s21c1
Sequence:CCGGTTGGTGCGGCATCGTCGTTATCTCGAGATAACGACGATGCCGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181322
VALIDATED
CTCF MISSION shRNA shRNA Plasmid DNA
CCCTC-binding factor (zinc finger protein)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-752s21c1
Sequence:CCGGCAGAAAGTGAACCGATGATATCTCGAGATATCATCGGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2991s21c1
Sequence:CCGGTGGCATGCTACGATCAGTTTCCTCGAGGAAACTGATCGTAGCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1677s21c1
Sequence:CCGGGCGAAAGCAGCATTCCTATATCTCGAGATATAGGAATGCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1013s21c1
Sequence:CCGGGACTGCTGTCTGAGGTTAATGCTCGAGCATTAACCTCAGACAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-2371s21c1
Sequence:CCGGGGTGCAATTGAGAACATTATACTCGAGTATAATGTTCTCAATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-578s21c1
Sequence:CCGGTGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2601s21c1
Sequence:CCGGGGCTTTGGGAACGGCATAATTCTCGAGAATTATGCCGTTCCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1318s21c1
Sequence:CCGGTTGGTGCGGCATCGTCGTTATCTCGAGATAACGACGATGCCGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181322
VALIDATED
CTCF MISSION shRNA Lentiviral Transduction Particles
CCCTC-binding factor (zinc finger protein)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-752s21c1
Sequence:CCGGCAGAAAGTGAACCGATGATATCTCGAGATATCATCGGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2991s21c1
Sequence:CCGGTGGCATGCTACGATCAGTTTCCTCGAGGAAACTGATCGTAGCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1677s21c1
Sequence:CCGGGCGAAAGCAGCATTCCTATATCTCGAGATATAGGAATGCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1013s21c1
Sequence:CCGGGACTGCTGTCTGAGGTTAATGCTCGAGCATTAACCTCAGACAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-2371s21c1
Sequence:CCGGGGTGCAATTGAGAACATTATACTCGAGTATAATGTTCTCAATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181322.3-578s21c1
Sequence:CCGGTGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181322.3-2601s21c1
Sequence:CCGGGGCTTTGGGAACGGCATAATTCTCGAGAATTATGCCGTTCCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181322.3-1318s21c1
Sequence:CCGGTTGGTGCGGCATCGTCGTTATCTCGAGATAACGACGATGCCGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006565
VALIDATED
CTCF MISSION shRNA Bacterial Glycerol Stock
CCCTC-binding factor (zinc finger protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-3293s21c1
Sequence:GTACCGGTATGATTTCCCATCGACATTTCTCGAGAAATGTCGATGGGAAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1757s21c1
Sequence:CCGGCAAGAATGAGAAGCGCTTTAACTCGAGTTAAAGCGCTTCTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1110s21c1
Sequence:CCGGACGTGTCCACGGCGTTCAAATCTCGAGATTTGAACGCCGTGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006565.2-558s21c1
Sequence:CCGGGTGGACGATACCCAGATTATACTCGAGTATAATCTGGGTATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1711s1c1
Sequence:CCGGGCTGTGTTTCATGAGCGCTATCTCGAGATAGCGCTCATGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-733s1c1
Sequence:CCGGGCGGAAAGTGAACCCATGATACTCGAGTATCATGGGTTCACTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006565.1-2989s1c1
Sequence:CCGGGCCTCTTTCTTGGCAAAGTTTCTCGAGAAACTTTGCCAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1683s1c1
Sequence:CCGGGCAAGGCAAGAAATGCCGTTACTCGAGTAACGGCATTTCTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1212s1c1
Sequence:CCGGCCTCCTGAGGAATCACCTTAACTCGAGTTAAGGTGATTCCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006565
VALIDATED
CTCF MISSION shRNA shRNA Plasmid DNA
CCCTC-binding factor (zinc finger protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-3293s21c1
Sequence:GTACCGGTATGATTTCCCATCGACATTTCTCGAGAAATGTCGATGGGAAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1757s21c1
Sequence:CCGGCAAGAATGAGAAGCGCTTTAACTCGAGTTAAAGCGCTTCTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1110s21c1
Sequence:CCGGACGTGTCCACGGCGTTCAAATCTCGAGATTTGAACGCCGTGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006565.2-558s21c1
Sequence:CCGGGTGGACGATACCCAGATTATACTCGAGTATAATCTGGGTATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1711s1c1
Sequence:CCGGGCTGTGTTTCATGAGCGCTATCTCGAGATAGCGCTCATGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-733s1c1
Sequence:CCGGGCGGAAAGTGAACCCATGATACTCGAGTATCATGGGTTCACTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006565.1-2989s1c1
Sequence:CCGGGCCTCTTTCTTGGCAAAGTTTCTCGAGAAACTTTGCCAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1683s1c1
Sequence:CCGGGCAAGGCAAGAAATGCCGTTACTCGAGTAACGGCATTTCTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1212s1c1
Sequence:CCGGCCTCCTGAGGAATCACCTTAACTCGAGTTAAGGTGATTCCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006565
VALIDATED
CTCF MISSION shRNA Lentiviral Transduction Particles
CCCTC-binding factor (zinc finger protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-3293s21c1
Sequence:GTACCGGTATGATTTCCCATCGACATTTCTCGAGAAATGTCGATGGGAAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1757s21c1
Sequence:CCGGCAAGAATGAGAAGCGCTTTAACTCGAGTTAAAGCGCTTCTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006565.2-1110s21c1
Sequence:CCGGACGTGTCCACGGCGTTCAAATCTCGAGATTTGAACGCCGTGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006565.2-558s21c1
Sequence:CCGGGTGGACGATACCCAGATTATACTCGAGTATAATCTGGGTATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1711s1c1
Sequence:CCGGGCTGTGTTTCATGAGCGCTATCTCGAGATAGCGCTCATGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-733s1c1
Sequence:CCGGGCGGAAAGTGAACCCATGATACTCGAGTATCATGGGTTCACTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006565.1-2989s1c1
Sequence:CCGGGCCTCTTTCTTGGCAAAGTTTCTCGAGAAACTTTGCCAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1683s1c1
Sequence:CCGGGCAAGGCAAGAAATGCCGTTACTCGAGTAACGGCATTTCTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006565.1-1212s1c1
Sequence:CCGGCCTCCTGAGGAATCACCTTAACTCGAGTTAAGGTGATTCCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007794
CTCF MISSION shRNA Bacterial Glycerol Stock
CCCTC-binding factor (zinc finger protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-1030s1c1
Sequence:CCGGGCAGAGAAAGTAGTTGGTAATCTCGAGATTACCAACTACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2005s1c1
Sequence:CCGGCGGAACACAATGGCAAGACATCTCGAGATGTCTTGCCATTGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-760s1c1
Sequence:CCGGCCGATGATATGTCACACCTTACTCGAGTAAGGTGTGACATATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2338s1c1
Sequence:CCGGGCCATCATTCAGGTCGAAGATCTCGAGATCTTCGACCTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-625s1c1
Sequence:CCGGCCCATTAACATAGGAGAGCTTCTCGAGAAGCTCTCCTATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007794
CTCF MISSION shRNA shRNA Plasmid DNA
CCCTC-binding factor (zinc finger protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-1030s1c1
Sequence:CCGGGCAGAGAAAGTAGTTGGTAATCTCGAGATTACCAACTACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2005s1c1
Sequence:CCGGCGGAACACAATGGCAAGACATCTCGAGATGTCTTGCCATTGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-760s1c1
Sequence:CCGGCCGATGATATGTCACACCTTACTCGAGTAAGGTGTGACATATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2338s1c1
Sequence:CCGGGCCATCATTCAGGTCGAAGATCTCGAGATCTTCGACCTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-625s1c1
Sequence:CCGGCCCATTAACATAGGAGAGCTTCTCGAGAAGCTCTCCTATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007794
CTCF MISSION shRNA Lentiviral Transduction Particles
CCCTC-binding factor (zinc finger protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-1030s1c1
Sequence:CCGGGCAGAGAAAGTAGTTGGTAATCTCGAGATTACCAACTACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2005s1c1
Sequence:CCGGCGGAACACAATGGCAAGACATCTCGAGATGTCTTGCCATTGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-760s1c1
Sequence:CCGGCCGATGATATGTCACACCTTACTCGAGTAAGGTGTGACATATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-2338s1c1
Sequence:CCGGGCCATCATTCAGGTCGAAGATCTCGAGATCTTCGACCTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007794.1-625s1c1
Sequence:CCGGCCCATTAACATAGGAGAGCTTCTCGAGAAGCTCTCCTATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks