EMAIL THIS PAGE TO A FRIEND

CTCFL

CCCTC-binding factor (zinc finger protein)-like

120 Gene Product Result for
Synonyms: BORIS CT27 CTCF-T HMGB1L1 dJ579F20.2
Gene ID:
Human(140690) Summary: CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(664799) CCCTC-binding factor (zinc finger protein)-like
Rat(296420) CCCTC-binding factor (zinc finger protein)-like
sheep(101117605) CCCTC-binding factor (zinc finger protein)-like
domestic guinea pig(100730979) CCCTC-binding factor (zinc finger protein)-like
naked mole-rat(101708375) CCCTC-binding factor (zinc finger protein)-like
dog(477271) CCCTC-binding factor (zinc finger protein)-like
domestic cat(101089508) CCCTC-binding factor (zinc finger protein)-like
cow(100144618) CCCTC-binding factor (zinc finger protein)-like
Horse(100055665) CCCTC-binding factor (zinc finger protein)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130751 MISSION® esiRNA esiRNA human CTCFL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080618 Rosetta Predictions human pricing
NM_001081387 Rosetta Predictions mouse pricing
XM_972768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199096 predicted 1617
2 SASI_Hs01_00199097 predicted 1674
3 SASI_Hs01_00199098 predicted 1990
4 SASI_Hs02_00362366 predicted 1654
5 SASI_Hs01_00199099 predicted 718
6 SASI_Hs01_00199100 predicted 1695
7 SASI_Hs01_00199101 predicted 364
8 SASI_Hs01_00199102 predicted 1684
9 SASI_Hs01_00199103 predicted 695
10 SASI_Hs01_00199104 predicted 1667
11 SASI_Hs01_00199105 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297901 predicted 710
2 SASI_Mm02_00297902 predicted 898
3 SASI_Mm02_00297903 predicted 1433
4 SASI_Mm02_00297904 predicted 272
5 SASI_Mm02_00297905 predicted 1844
6 SASI_Mm02_00297906 predicted 1388
7 SASI_Mm02_00297907 predicted 871
8 SASI_Mm02_00297908 predicted 1712
9 SASI_Mm02_00297909 predicted 1628
10 SASI_Mm02_00297910 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_972768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280536 predicted 901
2 SASI_Mm01_00280537 predicted 1443
3 SASI_Mm01_00280538 predicted 1619
4 SASI_Mm01_00280539 predicted 280
5 SASI_Mm01_00280540 predicted 1844
6 SASI_Mm01_00280541 predicted 1390
7 SASI_Mm01_00280542 predicted 881
8 SASI_Mm01_00280543 predicted 1717
9 SASI_Mm01_00280544 predicted 1635
10 SASI_Mm01_00280545 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080618
VALIDATED
CTCFL MISSION shRNA Bacterial Glycerol Stock
CCCTC-binding factor (zinc finger protein)-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080618.2-2050s1c1
Sequence:CCGGGCTCCTCAACACGATGGATAACTCGAGTTATCCATCGTGTTGAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-569s1c1
Sequence:CCGGGCCAGTGAAGACAGTAAGTTACTCGAGTAACTTACTGTCTTCACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-380s1c1
Sequence:CCGGCTGAGCATACAGCAGCAAGAACTCGAGTTCTTGCTGCTGTATGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1475s1c1
Sequence:CCGGGCTGTCTTCCATGAACGCTATCTCGAGATAGCGTTCATGGAAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1660s1c1
Sequence:CCGGGCAACTTCTAAACGCTCACTTCTCGAGAAGTGAGCGTTTAGAAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-707s21c1
Sequence:CCGGGATGAAAGAAGTGACGAAATTCTCGAGAATTTCGTCACTTCTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1067s21c1
Sequence:CCGGGTCCGACACAGGCGCTATAAACTCGAGTTTATAGCGCCTGTGTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2396s21c1
Sequence:CCGGATGGATTCATTCACTTGATATCTCGAGATATCAAGTGAATGAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-114s21c1
Sequence:CCGGAGCAATTCACCAAGATCAAAGCTCGAGCTTTGATCTTGGTGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2308s21c1
Sequence:CCGGCCTGTTTGTAGCTGGATATTTCTCGAGAAATATCCAGCTACAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1651s21c1
Sequence:CCGGCCGACAGAAGCAACTTCTAAACTCGAGTTTAGAAGTTGCTTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-476s21c1
Sequence:CCGGCAGTGTGTGGCCATTAGTATCCTCGAGGATACTAATGGCCACACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080618
VALIDATED
CTCFL MISSION shRNA shRNA Plasmid DNA
CCCTC-binding factor (zinc finger protein)-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080618.2-2050s1c1
Sequence:CCGGGCTCCTCAACACGATGGATAACTCGAGTTATCCATCGTGTTGAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-569s1c1
Sequence:CCGGGCCAGTGAAGACAGTAAGTTACTCGAGTAACTTACTGTCTTCACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-380s1c1
Sequence:CCGGCTGAGCATACAGCAGCAAGAACTCGAGTTCTTGCTGCTGTATGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1475s1c1
Sequence:CCGGGCTGTCTTCCATGAACGCTATCTCGAGATAGCGTTCATGGAAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1660s1c1
Sequence:CCGGGCAACTTCTAAACGCTCACTTCTCGAGAAGTGAGCGTTTAGAAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-707s21c1
Sequence:CCGGGATGAAAGAAGTGACGAAATTCTCGAGAATTTCGTCACTTCTTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1067s21c1
Sequence:CCGGGTCCGACACAGGCGCTATAAACTCGAGTTTATAGCGCCTGTGTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2396s21c1
Sequence:CCGGATGGATTCATTCACTTGATATCTCGAGATATCAAGTGAATGAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-114s21c1
Sequence:CCGGAGCAATTCACCAAGATCAAAGCTCGAGCTTTGATCTTGGTGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2308s21c1
Sequence:CCGGCCTGTTTGTAGCTGGATATTTCTCGAGAAATATCCAGCTACAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1651s21c1
Sequence:CCGGCCGACAGAAGCAACTTCTAAACTCGAGTTTAGAAGTTGCTTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-476s21c1
Sequence:CCGGCAGTGTGTGGCCATTAGTATCCTCGAGGATACTAATGGCCACACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080618
VALIDATED
CTCFL MISSION shRNA Lentiviral Transduction Particles
CCCTC-binding factor (zinc finger protein)-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_080618.2-2050s1c1
Sequence:CCGGGCTCCTCAACACGATGGATAACTCGAGTTATCCATCGTGTTGAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-569s1c1
Sequence:CCGGGCCAGTGAAGACAGTAAGTTACTCGAGTAACTTACTGTCTTCACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-380s1c1
Sequence:CCGGCTGAGCATACAGCAGCAAGAACTCGAGTTCTTGCTGCTGTATGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1475s1c1
Sequence:CCGGGCTGTCTTCCATGAACGCTATCTCGAGATAGCGTTCATGGAAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080618.2-1660s1c1
Sequence:CCGGGCAACTTCTAAACGCTCACTTCTCGAGAAGTGAGCGTTTAGAAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-707s21c1
Sequence:CCGGGATGAAAGAAGTGACGAAATTCTCGAGAATTTCGTCACTTCTTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1067s21c1
Sequence:CCGGGTCCGACACAGGCGCTATAAACTCGAGTTTATAGCGCCTGTGTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2396s21c1
Sequence:CCGGATGGATTCATTCACTTGATATCTCGAGATATCAAGTGAATGAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-114s21c1
Sequence:CCGGAGCAATTCACCAAGATCAAAGCTCGAGCTTTGATCTTGGTGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080618.2-2308s21c1
Sequence:CCGGCCTGTTTGTAGCTGGATATTTCTCGAGAAATATCCAGCTACAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080618.2-1651s21c1
Sequence:CCGGCCGACAGAAGCAACTTCTAAACTCGAGTTTAGAAGTTGCTTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080618.2-476s21c1
Sequence:CCGGCAGTGTGTGGCCATTAGTATCCTCGAGGATACTAATGGCCACACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081387
CTCFL MISSION shRNA Bacterial Glycerol Stock
CCCTC-binding factor (zinc finger protein)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-880s21c1
Sequence:CCGGACGAAATTGTCCTGACCATTTCTCGAGAAATGGTCAGGACAATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-2116s21c1
Sequence:CCGGACGGCCTTACCTGCGAGATAACTCGAGTTATCTCGCAGGTAAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-280s21c1
Sequence:CCGGGGTACTTCACCCAGATCAAAGCTCGAGCTTTGATCTGGGTGAAGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081387.2-2933s21c1
Sequence:CCGGCTTGTAGGCCTATGGGTTAAACTCGAGTTTAACCCATAGGCCTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-671s21c1
Sequence:CCGGGGAGCTGCAGCGGATACATTTCTCGAGAAATGTATCCGCTGCAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081387
CTCFL MISSION shRNA shRNA Plasmid DNA
CCCTC-binding factor (zinc finger protein)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-880s21c1
Sequence:CCGGACGAAATTGTCCTGACCATTTCTCGAGAAATGGTCAGGACAATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-2116s21c1
Sequence:CCGGACGGCCTTACCTGCGAGATAACTCGAGTTATCTCGCAGGTAAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-280s21c1
Sequence:CCGGGGTACTTCACCCAGATCAAAGCTCGAGCTTTGATCTGGGTGAAGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081387.2-2933s21c1
Sequence:CCGGCTTGTAGGCCTATGGGTTAAACTCGAGTTTAACCCATAGGCCTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-671s21c1
Sequence:CCGGGGAGCTGCAGCGGATACATTTCTCGAGAAATGTATCCGCTGCAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081387
CTCFL MISSION shRNA Lentiviral Transduction Particles
CCCTC-binding factor (zinc finger protein)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-880s21c1
Sequence:CCGGACGAAATTGTCCTGACCATTTCTCGAGAAATGGTCAGGACAATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-2116s21c1
Sequence:CCGGACGGCCTTACCTGCGAGATAACTCGAGTTATCTCGCAGGTAAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-280s21c1
Sequence:CCGGGGTACTTCACCCAGATCAAAGCTCGAGCTTTGATCTGGGTGAAGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081387.2-2933s21c1
Sequence:CCGGCTTGTAGGCCTATGGGTTAAACTCGAGTTTAACCCATAGGCCTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081387.2-671s21c1
Sequence:CCGGGGAGCTGCAGCGGATACATTTCTCGAGAAATGTATCCGCTGCAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)