EMAIL THIS PAGE TO A FRIEND

CTDNEP1

CTD nuclear envelope phosphatase 1

84 Gene Product Result for
Synonyms: DULLARD HSA011916 NET56
UniProtKB ID: O95476, D3DTN7, Q96GQ9
Gene ID:
Mouse(67181) CTD nuclear envelope phosphatase 1
Rat(287447) CTD nuclear envelope phosphatase 1
dog(607484) CTD nuclear envelope phosphatase 1
cow(509192) CTD nuclear envelope phosphatase 1
domestic cat(101094889) CTD nuclear envelope phosphatase 1
naked mole-rat(101712430) CTD nuclear envelope phosphatase 1
domestic guinea pig(100713351) CTD nuclear envelope phosphatase 1
sheep(101118539) CTD nuclear envelope phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037439 Anti-CTDNEP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1307164 ANTI-DULLARD (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2100632 Anti-DULLARD antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, horse, zebrafish, human, canine, bovine, guinea pig,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015343 Rosetta Predictions human pricing
XM_001079431 Rosetta Predictions rat pricing
XM_001080620 Rosetta Predictions rat pricing
NM_026017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188421 predicted 1238
2 SASI_Hs01_00188422 predicted 728
3 SASI_Hs01_00188424 predicted 978
4 SASI_Hs01_00188425 predicted 925
5 SASI_Hs01_00188426 predicted 851
6 SASI_Hs01_00188427 predicted 732
7 SASI_Hs01_00188428 predicted 706
8 SASI_Hs02_00347650 predicted 888
9 SASI_Hs01_00188429 predicted 847
10 SASI_Hs01_00188430 predicted 1008
11 SASI_Hs01_00188423 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364369 predicted 476
2 SASI_Rn02_00364370 predicted 884
3 SASI_Rn02_00364371 predicted 928
4 SASI_Rn02_00364372 predicted 277
5 SASI_Rn02_00364373 predicted 292
6 SASI_Rn02_00364374 predicted 703
7 SASI_Rn02_00364375 predicted 490
8 SASI_Rn02_00364376 predicted 367
9 SASI_Rn02_00364377 predicted 639
10 SASI_Rn02_00364378 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368670 predicted 276
2 SASI_Rn02_00368671 predicted 418
3 SASI_Rn02_00368672 predicted 299
4 SASI_Rn02_00368673 predicted 330
5 SASI_Rn02_00368674 predicted 364
6 SASI_Rn02_00368675 predicted 195
7 SASI_Rn02_00368676 predicted 389
8 SASI_Rn02_00368677 predicted 256
9 SASI_Rn02_00368678 predicted 373
10 SASI_Rn02_00368679 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067864 predicted 798
2 SASI_Mm01_00067865 predicted 1234
3 SASI_Mm01_00067866 predicted 1106
4 SASI_Mm01_00067867 predicted 1196
5 SASI_Mm01_00067868 predicted 787
6 SASI_Mm02_00329483 predicted 1112
7 SASI_Mm01_00067870 predicted 1242
8 SASI_Mm01_00067871 predicted 1012
9 SASI_Mm02_00329484 predicted 1243
10 SASI_Mm01_00067872 predicted 801
11 SASI_Mm01_00067863 predicted 1188
12 SASI_Mm01_00067869 predicted 729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015343
VALIDATED
CTDNEP1 MISSION shRNA Bacterial Glycerol Stock
CTD nuclear envelope phosphatase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015343.4-1374s21c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-1048s21c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-545s21c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-986s21c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-646s21c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1373s1c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-645s1c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1047s1c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-985s1c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-544s1c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015343
VALIDATED
CTDNEP1 MISSION shRNA shRNA Plasmid DNA
CTD nuclear envelope phosphatase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015343.4-1374s21c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-1048s21c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-545s21c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-986s21c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-646s21c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1373s1c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-645s1c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1047s1c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-985s1c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-544s1c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015343
VALIDATED
CTDNEP1 MISSION shRNA Lentiviral Transduction Particles
CTD nuclear envelope phosphatase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015343.4-1374s21c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-1048s21c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-545s21c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-986s21c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015343.4-646s21c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1373s1c1
Sequence:CCGGCCTCACTCTTAACTTCGTGTTCTCGAGAACACGAAGTTAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-645s1c1
Sequence:CCGGGATCTGGATGAGACACTTATTCTCGAGAATAAGTGTCTCATCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-1047s1c1
Sequence:CCGGCCCATCAAATCCTGGTTCAGTCTCGAGACTGAACCAGGATTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-985s1c1
Sequence:CCGGCCAGCATTGTGATCCTGGATACTCGAGTATCCAGGATCACAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015343.3-544s1c1
Sequence:CCGGGCACGGTAATTCAGTACCAAACTCGAGTTTGGTACTGAATTACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026017
VALIDATED
CTDNEP1 MISSION shRNA Bacterial Glycerol Stock
CTD nuclear envelope phosphatase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-593s21c1
Sequence:CCGGTTCATCCTCAAGGTGGTAATACTCGAGTATTACCACCTTGAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-1021s21c1
Sequence:CCGGCCGAAACCTTCACCAACATAGCTCGAGCTATGTTGGTGAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026017.2-425s1c1
Sequence:CCGGCAGTATCAGACTGTTCGATATCTCGAGATATCGAACAGTCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-430s21c1
Sequence:CCGGTCAGACTGTTCGATATGATATCTCGAGATATCATATCGAACAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026017.2-1250s21c1
Sequence:CCGGGGGTTCACACTCCGTGGAAATCTCGAGATTTCCACGGAGTGTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-404s21c1
Sequence:CCGGAGGCAGATCCGCACGGTAATTCTCGAGAATTACCGTGCGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1371s1c1
Sequence:CCGGCCAATTCAACTTTGTTGTGATCTCGAGATCACAACAAAGTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1370s1c1
Sequence:CCGGGCCAATTCAACTTTGTTGTGACTCGAGTCACAACAAAGTTGAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026017
VALIDATED
CTDNEP1 MISSION shRNA shRNA Plasmid DNA
CTD nuclear envelope phosphatase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-593s21c1
Sequence:CCGGTTCATCCTCAAGGTGGTAATACTCGAGTATTACCACCTTGAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-1021s21c1
Sequence:CCGGCCGAAACCTTCACCAACATAGCTCGAGCTATGTTGGTGAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026017.2-425s1c1
Sequence:CCGGCAGTATCAGACTGTTCGATATCTCGAGATATCGAACAGTCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-430s21c1
Sequence:CCGGTCAGACTGTTCGATATGATATCTCGAGATATCATATCGAACAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026017.2-1250s21c1
Sequence:CCGGGGGTTCACACTCCGTGGAAATCTCGAGATTTCCACGGAGTGTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-404s21c1
Sequence:CCGGAGGCAGATCCGCACGGTAATTCTCGAGAATTACCGTGCGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1371s1c1
Sequence:CCGGCCAATTCAACTTTGTTGTGATCTCGAGATCACAACAAAGTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1370s1c1
Sequence:CCGGGCCAATTCAACTTTGTTGTGACTCGAGTCACAACAAAGTTGAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026017
VALIDATED
CTDNEP1 MISSION shRNA Lentiviral Transduction Particles
CTD nuclear envelope phosphatase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-593s21c1
Sequence:CCGGTTCATCCTCAAGGTGGTAATACTCGAGTATTACCACCTTGAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-1021s21c1
Sequence:CCGGCCGAAACCTTCACCAACATAGCTCGAGCTATGTTGGTGAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026017.2-425s1c1
Sequence:CCGGCAGTATCAGACTGTTCGATATCTCGAGATATCGAACAGTCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-430s21c1
Sequence:CCGGTCAGACTGTTCGATATGATATCTCGAGATATCATATCGAACAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026017.2-1250s21c1
Sequence:CCGGGGGTTCACACTCCGTGGAAATCTCGAGATTTCCACGGAGTGTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026017.2-404s21c1
Sequence:CCGGAGGCAGATCCGCACGGTAATTCTCGAGAATTACCGTGCGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1371s1c1
Sequence:CCGGCCAATTCAACTTTGTTGTGATCTCGAGATCACAACAAAGTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026017.1-1370s1c1
Sequence:CCGGGCCAATTCAACTTTGTTGTGACTCGAGTCACAACAAAGTTGAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks