EMAIL THIS PAGE TO A FRIEND

CTDP1

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

Synonyms: CCFDN FCP1
UniProtKB ID: Q9Y5B0, A8MY97, Q7Z644, Q96BZ1, Q9Y6F5
Gene ID:
Human(9150) Summary: This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(67655) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Rat(291414) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Zebrafish(442930) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
cow(100336537) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Horse(100065422) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
domestic cat(101101511) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
dog(476158) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
chicken(420813) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
sheep(101107836) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
domestic guinea pig(100735336) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
naked mole-rat(101696942) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004715 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012111 MISSION® esiRNA esiRNA targeting mouse Ctdp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004715 Rosetta Predictions human pricing
NM_048368 Rosetta Predictions human pricing
NM_001106131 Rosetta Predictions rat pricing
NM_026295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138624 predicted 756
2 SASI_Hs01_00138625 predicted 3159
3 SASI_Hs01_00138626 predicted 959
4 SASI_Hs01_00138627 predicted 1166
5 SASI_Hs01_00138628 predicted 1035
6 SASI_Hs01_00138629 predicted 1005
7 SASI_Hs01_00138630 predicted 1091
8 SASI_Hs01_00138631 predicted 719
9 SASI_Hs01_00138632 predicted 999
10 SASI_Hs01_00138633 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_048368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192174 predicted 752
2 SASI_Hs01_00192175 predicted 2988
3 SASI_Hs01_00192176 predicted 965
4 SASI_Hs01_00192177 predicted 1167
5 SASI_Hs01_00192178 predicted 1034
6 SASI_Hs01_00192180 predicted 1004
7 SASI_Hs01_00192181 predicted 1088
8 SASI_Hs01_00192182 predicted 716
9 SASI_Hs01_00192183 predicted 999
10 SASI_Hs02_00361485 predicted 1038
11 SASI_Hs01_00192179 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215928 predicted 2701
2 SASI_Rn02_00215929 predicted 2677
3 SASI_Rn02_00215930 predicted 3151
4 SASI_Rn02_00215931 predicted 853
5 SASI_Rn02_00215932 predicted 1892
6 SASI_Rn02_00215933 predicted 987
7 SASI_Rn02_00215934 predicted 1935
8 SASI_Rn02_00215935 predicted 2393
9 SASI_Rn02_00215936 predicted 650
10 SASI_Rn02_00215937 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196625 predicted 2641
2 SASI_Mm02_00329996 predicted 1123
3 SASI_Mm01_00196626 predicted 437
4 SASI_Mm01_00196628 predicted 932
5 SASI_Mm01_00196629 predicted 1121
6 SASI_Mm01_00196630 predicted 1993
7 SASI_Mm01_00196631 predicted 967
8 SASI_Mm01_00196632 predicted 1031
9 SASI_Mm01_00196633 predicted 2003
10 SASI_Mm01_00196634 predicted 2985
11 SASI_Mm01_00196627 predicted 3102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026295
VALIDATED
CTDP1 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1885s1c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-2023s1c1
Sequence:CCGGGCACCCAACAAACTTTCCTGTCTCGAGACAGGAAAGTTTGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-727s1c1
Sequence:CCGGCCAGATGTCCAACAAAGGCATCTCGAGATGCCTTTGTTGGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026295.2-3311s1c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1030s1c1
Sequence:CCGGCCGAGAAGATGTGTGGAAGTTCTCGAGAACTTCCACACATCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1845s21c1
Sequence:CCGGACGACGATGACCACTTGATACCTCGAGGTATCAAGTGGTCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-2287s21c1
Sequence:CCGGTACCCGCACACATAGGGATAACTCGAGTTATCCCTATGTGTGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026295.2-1938s21c1
Sequence:CCGGTTGAGGAAGCTCCAGATATACCTCGAGGTATATCTGGAGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026295.2-3311s21c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1885s21c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026295
VALIDATED
CTDP1 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1885s1c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-2023s1c1
Sequence:CCGGGCACCCAACAAACTTTCCTGTCTCGAGACAGGAAAGTTTGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-727s1c1
Sequence:CCGGCCAGATGTCCAACAAAGGCATCTCGAGATGCCTTTGTTGGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026295.2-3311s1c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1030s1c1
Sequence:CCGGCCGAGAAGATGTGTGGAAGTTCTCGAGAACTTCCACACATCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1845s21c1
Sequence:CCGGACGACGATGACCACTTGATACCTCGAGGTATCAAGTGGTCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-2287s21c1
Sequence:CCGGTACCCGCACACATAGGGATAACTCGAGTTATCCCTATGTGTGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026295.2-1938s21c1
Sequence:CCGGTTGAGGAAGCTCCAGATATACCTCGAGGTATATCTGGAGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026295.2-3311s21c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1885s21c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026295
VALIDATED
CTDP1 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1885s1c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-2023s1c1
Sequence:CCGGGCACCCAACAAACTTTCCTGTCTCGAGACAGGAAAGTTTGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-727s1c1
Sequence:CCGGCCAGATGTCCAACAAAGGCATCTCGAGATGCCTTTGTTGGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026295.2-3311s1c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026295.2-1030s1c1
Sequence:CCGGCCGAGAAGATGTGTGGAAGTTCTCGAGAACTTCCACACATCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1845s21c1
Sequence:CCGGACGACGATGACCACTTGATACCTCGAGGTATCAAGTGGTCATCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-2287s21c1
Sequence:CCGGTACCCGCACACATAGGGATAACTCGAGTTATCCCTATGTGTGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026295.2-1938s21c1
Sequence:CCGGTTGAGGAAGCTCCAGATATACCTCGAGGTATATCTGGAGCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026295.2-3311s21c1
Sequence:CCGGCCAGTAAGATTTAGAGAGCAACTCGAGTTGCTCTCTAAATCTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026295.2-1885s21c1
Sequence:CCGGCCGAGTACACACTGACTATTACTCGAGTAATAGTCAGTGTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004715
CTDP1 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-840s1c1
Sequence:CCGGGCACACACCATCGCAGGCTTTCTCGAGAAAGCCTGCGATGGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1098s1c1
Sequence:CCGGCAGACGAGAAAGAAAGTAAATCTCGAGATTTACTTTCTTTCTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004715.x-3330s1c1
Sequence:CCGGACGAGACATGGACTAGGAGTTCTCGAGAACTCCTAGTCCATGTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1895s1c1
Sequence:CCGGCTATGCCAAGTATGACCGCTACTCGAGTAGCGGTCATACTTGGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-934s1c1
Sequence:CCGGCGGGAAACCTTAGAAATCTCTCTCGAGAGAGATTTCTAAGGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-970s21c1
Sequence:CCGGGATGAATGTATTGACCCATTTCTCGAGAAATGGGTCAATACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1153s21c1
Sequence:CCGGCGAGAATCTCAGACGAGAAAGCTCGAGCTTTCTCGTCTGAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-748s21c1
Sequence:CCGGTGTCAGCAGATGTCGAATAAACTCGAGTTTATTCGACATCTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-710s21c1
Sequence:CCGGACTTGGACCAGACGTTGATTCCTCGAGGAATCAACGTCTGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-2048s21c1
Sequence:CCGGTGGCAGACGTGGCCATAATTTCTCGAGAAATTATGGCCACGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3487s21c1
Sequence:CCGGTCCCTCCTAGGGAACCCATTTCTCGAGAAATGGGTTCCCTAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1031s21c1
Sequence:CCGGACTCAATGGTTTGCATTATTGCTCGAGCAATAATGCAAACCATTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3229s21c1
Sequence:CCGGTTGTAAGTGACAGGTGTTAAACTCGAGTTTAACACCTGTCACTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004715
CTDP1 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-840s1c1
Sequence:CCGGGCACACACCATCGCAGGCTTTCTCGAGAAAGCCTGCGATGGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1098s1c1
Sequence:CCGGCAGACGAGAAAGAAAGTAAATCTCGAGATTTACTTTCTTTCTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004715.x-3330s1c1
Sequence:CCGGACGAGACATGGACTAGGAGTTCTCGAGAACTCCTAGTCCATGTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1895s1c1
Sequence:CCGGCTATGCCAAGTATGACCGCTACTCGAGTAGCGGTCATACTTGGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-934s1c1
Sequence:CCGGCGGGAAACCTTAGAAATCTCTCTCGAGAGAGATTTCTAAGGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-970s21c1
Sequence:CCGGGATGAATGTATTGACCCATTTCTCGAGAAATGGGTCAATACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1153s21c1
Sequence:CCGGCGAGAATCTCAGACGAGAAAGCTCGAGCTTTCTCGTCTGAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-748s21c1
Sequence:CCGGTGTCAGCAGATGTCGAATAAACTCGAGTTTATTCGACATCTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-710s21c1
Sequence:CCGGACTTGGACCAGACGTTGATTCCTCGAGGAATCAACGTCTGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-2048s21c1
Sequence:CCGGTGGCAGACGTGGCCATAATTTCTCGAGAAATTATGGCCACGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3487s21c1
Sequence:CCGGTCCCTCCTAGGGAACCCATTTCTCGAGAAATGGGTTCCCTAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1031s21c1
Sequence:CCGGACTCAATGGTTTGCATTATTGCTCGAGCAATAATGCAAACCATTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3229s21c1
Sequence:CCGGTTGTAAGTGACAGGTGTTAAACTCGAGTTTAACACCTGTCACTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004715
CTDP1 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-840s1c1
Sequence:CCGGGCACACACCATCGCAGGCTTTCTCGAGAAAGCCTGCGATGGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1098s1c1
Sequence:CCGGCAGACGAGAAAGAAAGTAAATCTCGAGATTTACTTTCTTTCTCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004715.x-3330s1c1
Sequence:CCGGACGAGACATGGACTAGGAGTTCTCGAGAACTCCTAGTCCATGTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-1895s1c1
Sequence:CCGGCTATGCCAAGTATGACCGCTACTCGAGTAGCGGTCATACTTGGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004715.x-934s1c1
Sequence:CCGGCGGGAAACCTTAGAAATCTCTCTCGAGAGAGATTTCTAAGGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-970s21c1
Sequence:CCGGGATGAATGTATTGACCCATTTCTCGAGAAATGGGTCAATACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1153s21c1
Sequence:CCGGCGAGAATCTCAGACGAGAAAGCTCGAGCTTTCTCGTCTGAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-748s21c1
Sequence:CCGGTGTCAGCAGATGTCGAATAAACTCGAGTTTATTCGACATCTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-710s21c1
Sequence:CCGGACTTGGACCAGACGTTGATTCCTCGAGGAATCAACGTCTGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-2048s21c1
Sequence:CCGGTGGCAGACGTGGCCATAATTTCTCGAGAAATTATGGCCACGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3487s21c1
Sequence:CCGGTCCCTCCTAGGGAACCCATTTCTCGAGAAATGGGTTCCCTAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004715.3-1031s21c1
Sequence:CCGGACTCAATGGTTTGCATTATTGCTCGAGCAATAATGCAAACCATTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004715.3-3229s21c1
Sequence:CCGGTTGTAAGTGACAGGTGTTAAACTCGAGTTTAACACCTGTCACTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks