EMAIL THIS PAGE TO A FRIEND

CTDSP1

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

93 Gene Product Result for
Synonyms: NIF3 NLI-IF NLIIF SCP1
UniProtKB ID: Q9GZU7, C9IYG0, Q7Z5Q3, Q7Z5Q4
Gene ID:
Human(58190) Summary: This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(227292) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Rat(363249) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
naked mole-rat(101706343) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
domestic guinea pig(100726065) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
sheep(101110306) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Zebrafish(553744) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
cow(516199) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
dog(608466) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
domestic cat(101087256) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
chicken(100857754) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021198 Rosetta Predictions human pricing
NM_182642 Rosetta Predictions human pricing
NM_001128079 Rosetta Predictions rat pricing
NM_153088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246571 predicted 670
2 SASI_Hs01_00246572 predicted 750
3 SASI_Hs01_00246573 predicted 958
4 SASI_Hs01_00246574 predicted 749
5 SASI_Hs01_00246575 predicted 757
6 SASI_Hs01_00246576 predicted 783
7 SASI_Hs01_00246577 predicted 653
8 SASI_Hs01_00246578 predicted 795
9 SASI_Hs01_00246579 predicted 1002
10 SASI_Hs02_00354782 predicted 657
11 SASI_Hs01_00246580 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063746 predicted 331
2 SASI_Hs01_00063747 predicted 408
3 SASI_Hs01_00063748 predicted 391
4 SASI_Hs01_00063749 predicted 373
5 SASI_Hs02_00370799 predicted 468
6 SASI_Hs01_00063750 predicted 418
7 SASI_Hs01_00063751 predicted 449
8 SASI_Hs01_00063752 predicted 315
9 SASI_Hs01_00063753 predicted 462
10 SASI_Hs01_00063754 predicted 303
11 SASI_Hs01_00063755 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254940 predicted 858
2 SASI_Rn02_00254941 predicted 721
3 SASI_Rn02_00254942 predicted 806
4 SASI_Rn02_00254943 predicted 528
5 SASI_Rn02_00254944 predicted 740
6 SASI_Rn02_00254945 predicted 528
7 SASI_Rn02_00254946 predicted 861
8 SASI_Rn02_00254947 predicted 374
9 SASI_Rn02_00254948 predicted 437
10 SASI_Rn02_00254949 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064401 predicted 908
2 SASI_Mm01_00064402 predicted 967
3 SASI_Mm01_00064403 predicted 995
4 SASI_Mm01_00064404 predicted 926
5 SASI_Mm01_00064405 predicted 1050
6 SASI_Mm01_00064406 predicted 1011
7 SASI_Mm01_00064407 predicted 648
8 SASI_Mm01_00064409 predicted 960
9 SASI_Mm01_00064410 predicted 833
10 SASI_Mm02_00342932 predicted 1023
11 SASI_Mm01_00064408 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021198
VALIDATED
CTDSP1 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-864s21c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-961s21c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-1004s21c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-645s21c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-1004s1c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-768s1c1
Sequence:CCGGGCTCTTTGAATGTGTGCTGTTCTCGAGAACAGCACACATTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-961s1c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-864s1c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-645s1c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021198
VALIDATED
CTDSP1 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-864s21c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-961s21c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-1004s21c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-645s21c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-1004s1c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-768s1c1
Sequence:CCGGGCTCTTTGAATGTGTGCTGTTCTCGAGAACAGCACACATTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-961s1c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-864s1c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-645s1c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021198
VALIDATED
CTDSP1 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-864s21c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-961s21c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-1004s21c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021198.1-645s21c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-1004s1c1
Sequence:CCGGCCTCGTGGTTTGACAACATGACTCGAGTCATGTTGTCAAACCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-768s1c1
Sequence:CCGGGCTCTTTGAATGTGTGCTGTTCTCGAGAACAGCACACATTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-961s1c1
Sequence:CCGGCCTGCCTCCTATGTCTTCCATCTCGAGATGGAAGACATAGGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-864s1c1
Sequence:CCGGGTTTCGAGAGTCCTGCGTCTTCTCGAGAAGACGCAGGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021198.1-645s1c1
Sequence:CCGGCAGCTCCTTCAAGCCAGTGAACTCGAGTTCACTGGCTTGAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153088
VALIDATED
CTDSP1 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-991s21c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153088.2-1522s21c1
Sequence:CCGGTGACCTGAGAGGAACCAATTTCTCGAGAAATTGGTTCCTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-889s21c1
Sequence:CCGGGCGAGTGCTCATTCTAGACAACTCGAGTTGTCTAGAATGAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-817s21c1
Sequence:CCGGGTTTCGAGAGTCGTGTGTCTTCTCGAGAAGACACACGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1512s1c1
Sequence:CCGGCCCTCTTTACTGGTCAGCTTTCTCGAGAAAGCTGACCAGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1016s1c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1017s1c1
Sequence:CCGGCACGATCTCTTACCCTTCTTTCTCGAGAAAGAAGGGTAAGAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153088
VALIDATED
CTDSP1 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-991s21c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153088.2-1522s21c1
Sequence:CCGGTGACCTGAGAGGAACCAATTTCTCGAGAAATTGGTTCCTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-889s21c1
Sequence:CCGGGCGAGTGCTCATTCTAGACAACTCGAGTTGTCTAGAATGAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-817s21c1
Sequence:CCGGGTTTCGAGAGTCGTGTGTCTTCTCGAGAAGACACACGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1512s1c1
Sequence:CCGGCCCTCTTTACTGGTCAGCTTTCTCGAGAAAGCTGACCAGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1016s1c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1017s1c1
Sequence:CCGGCACGATCTCTTACCCTTCTTTCTCGAGAAAGAAGGGTAAGAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153088
VALIDATED
CTDSP1 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-991s21c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153088.2-1522s21c1
Sequence:CCGGTGACCTGAGAGGAACCAATTTCTCGAGAAATTGGTTCCTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-889s21c1
Sequence:CCGGGCGAGTGCTCATTCTAGACAACTCGAGTTGTCTAGAATGAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153088.2-817s21c1
Sequence:CCGGGTTTCGAGAGTCGTGTGTCTTCTCGAGAAGACACACGACTCTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1512s1c1
Sequence:CCGGCCCTCTTTACTGGTCAGCTTTCTCGAGAAAGCTGACCAGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1016s1c1
Sequence:CCGGACACGATCTCTTACCCTTCTTCTCGAGAAGAAGGGTAAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153088.1-1017s1c1
Sequence:CCGGCACGATCTCTTACCCTTCTTTCTCGAGAAAGAAGGGTAAGAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks