EMAIL THIS PAGE TO A FRIEND

CTDSP2

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2

90 Gene Product Result for
Synonyms: OS4 PSR2 SCP2
UniProtKB ID: O14595, A8K5H4, Q53ZR2, Q6NZY3, Q9UEX1
Gene ID:
Mouse(52468) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Rat(100365370) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Zebrafish(321465) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
dog(481135) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
cow(506115) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
domestic guinea pig(100716288) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
naked mole-rat(101697795) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005730 Rosetta Predictions human pricing
NM_001113470 Rosetta Predictions mouse pricing
NM_146012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204467 predicted 822
2 SASI_Hs01_00204468 predicted 1179
3 SASI_Hs01_00204469 predicted 856
4 SASI_Hs01_00204470 predicted 1233
5 SASI_Hs01_00204471 predicted 1087
6 SASI_Hs01_00204473 predicted 1083
7 SASI_Hs01_00204474 predicted 859
8 SASI_Hs01_00204475 predicted 887
9 SASI_Hs01_00204476 predicted 853
10 SASI_Hs02_00340160 predicted 866
11 SASI_Hs01_00204472 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307943 predicted 1608
2 SASI_Mm02_00307944 predicted 1215
3 SASI_Mm02_00307945 predicted 1557
4 SASI_Mm02_00307946 predicted 1216
5 SASI_Mm02_00307947 predicted 1813
6 SASI_Mm02_00307948 predicted 1654
7 SASI_Mm02_00307949 predicted 1648
8 SASI_Mm02_00307950 predicted 1529
9 SASI_Mm02_00307951 predicted 1337
10 SASI_Mm02_00307952 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093902 predicted 918
2 SASI_Mm01_00093903 predicted 533
3 SASI_Mm01_00093904 predicted 869
4 SASI_Mm01_00093905 predicted 535
5 SASI_Mm01_00093907 predicted 1132
6 SASI_Mm02_00341564 predicted 972
7 SASI_Mm02_00341565 predicted 970
8 SASI_Mm01_00093908 predicted 847
9 SASI_Mm01_00093909 predicted 650
10 SASI_Mm01_00093910 predicted 843
11 SASI_Mm01_00093906 predicted 1089
12 SASI_Mm01_00093911 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005730
VALIDATED
CTDSP2 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-527s1c1
Sequence:CCGGGCTCCAGTGTCTCCAGTACCACTCGAGTGGTACTGGAGACACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-391s1c1
Sequence:CCGGCTAAGAAGCCTCGTGGACGTACTCGAGTACGTCCACGAGGCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005730.x-2662s1c1
Sequence:CCGGGAGGCAGGTATCACAAAGCATCTCGAGATGCTTTGTGATACCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-533s1c1
Sequence:CCGGGTGTCTCCAGTACCAGTTCTACTCGAGTAGAACTGGTACTGGAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-622s21c1
Sequence:CCGGGCCTCGTGGACGTAACATCTTCTCGAGAAGATGTTACGTCCACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-896s21c1
Sequence:CCGGGCTGACTTCATAGTGCCTATACTCGAGTATAGGCACTATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-698s21c1
Sequence:CCGGACTGAGCTCGCTGCGTATAAGCTCGAGCTTATACGCAGCGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1466s21c1
Sequence:CCGGAGTAACTGGAAAGAGCTTTAGCTCGAGCTAAAGCTCTTTCCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1717s21c1
Sequence:CCGGGTGTAGGGATGAAGACTATTGCTCGAGCAATAGTCTTCATCCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005730
VALIDATED
CTDSP2 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-527s1c1
Sequence:CCGGGCTCCAGTGTCTCCAGTACCACTCGAGTGGTACTGGAGACACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-391s1c1
Sequence:CCGGCTAAGAAGCCTCGTGGACGTACTCGAGTACGTCCACGAGGCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005730.x-2662s1c1
Sequence:CCGGGAGGCAGGTATCACAAAGCATCTCGAGATGCTTTGTGATACCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-533s1c1
Sequence:CCGGGTGTCTCCAGTACCAGTTCTACTCGAGTAGAACTGGTACTGGAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-622s21c1
Sequence:CCGGGCCTCGTGGACGTAACATCTTCTCGAGAAGATGTTACGTCCACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-896s21c1
Sequence:CCGGGCTGACTTCATAGTGCCTATACTCGAGTATAGGCACTATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-698s21c1
Sequence:CCGGACTGAGCTCGCTGCGTATAAGCTCGAGCTTATACGCAGCGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1466s21c1
Sequence:CCGGAGTAACTGGAAAGAGCTTTAGCTCGAGCTAAAGCTCTTTCCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1717s21c1
Sequence:CCGGGTGTAGGGATGAAGACTATTGCTCGAGCAATAGTCTTCATCCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005730
VALIDATED
CTDSP2 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-527s1c1
Sequence:CCGGGCTCCAGTGTCTCCAGTACCACTCGAGTGGTACTGGAGACACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-391s1c1
Sequence:CCGGCTAAGAAGCCTCGTGGACGTACTCGAGTACGTCCACGAGGCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005730.x-2662s1c1
Sequence:CCGGGAGGCAGGTATCACAAAGCATCTCGAGATGCTTTGTGATACCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005730.x-533s1c1
Sequence:CCGGGTGTCTCCAGTACCAGTTCTACTCGAGTAGAACTGGTACTGGAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-622s21c1
Sequence:CCGGGCCTCGTGGACGTAACATCTTCTCGAGAAGATGTTACGTCCACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-896s21c1
Sequence:CCGGGCTGACTTCATAGTGCCTATACTCGAGTATAGGCACTATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005730.3-698s21c1
Sequence:CCGGACTGAGCTCGCTGCGTATAAGCTCGAGCTTATACGCAGCGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1466s21c1
Sequence:CCGGAGTAACTGGAAAGAGCTTTAGCTCGAGCTAAAGCTCTTTCCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005730.3-1717s21c1
Sequence:CCGGGTGTAGGGATGAAGACTATTGCTCGAGCAATAGTCTTCATCCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146012
VALIDATED
CTDSP2 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-500s1c1
Sequence:CCGGCCCTGCATCTTACATCTTCCACTCGAGTGGAAGATGTAAGATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-2522s1c1
Sequence:CCGGCCCTGTTACTTCTCCATGAAACTCGAGTTTCATGGAGAAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-943s1c1
Sequence:CCGGCCCAAGTCATTTGTCTTCTTTCTCGAGAAAGAAGACAAATGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.2-591s1c1
Sequence:CCGGGAGCTAAGTGGAACTGATGATCTCGAGATCATCAGTTCCACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-1614s21c1
Sequence:CCGGCTCGTCTGCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGCAGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-644s21c1
Sequence:CCGGTTAGCCTTCCTGCTCCAAGAACTCGAGTTCTTGGAGCAGGAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-338s21c1
Sequence:CCGGTGCTGACCCTGTGACTGATCTCTCGAGAGATCAGTCACAGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-392s21c1
Sequence:CCGGGTTCCGAGAGGCTTGTGTGTTCTCGAGAACACACAAGCCTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146012
VALIDATED
CTDSP2 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-500s1c1
Sequence:CCGGCCCTGCATCTTACATCTTCCACTCGAGTGGAAGATGTAAGATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-2522s1c1
Sequence:CCGGCCCTGTTACTTCTCCATGAAACTCGAGTTTCATGGAGAAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-943s1c1
Sequence:CCGGCCCAAGTCATTTGTCTTCTTTCTCGAGAAAGAAGACAAATGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.2-591s1c1
Sequence:CCGGGAGCTAAGTGGAACTGATGATCTCGAGATCATCAGTTCCACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-1614s21c1
Sequence:CCGGCTCGTCTGCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGCAGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-644s21c1
Sequence:CCGGTTAGCCTTCCTGCTCCAAGAACTCGAGTTCTTGGAGCAGGAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-338s21c1
Sequence:CCGGTGCTGACCCTGTGACTGATCTCTCGAGAGATCAGTCACAGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-392s21c1
Sequence:CCGGGTTCCGAGAGGCTTGTGTGTTCTCGAGAACACACAAGCCTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146012
VALIDATED
CTDSP2 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-500s1c1
Sequence:CCGGCCCTGCATCTTACATCTTCCACTCGAGTGGAAGATGTAAGATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-2522s1c1
Sequence:CCGGCCCTGTTACTTCTCCATGAAACTCGAGTTTCATGGAGAAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.1-943s1c1
Sequence:CCGGCCCAAGTCATTTGTCTTCTTTCTCGAGAAAGAAGACAAATGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_146012.2-591s1c1
Sequence:CCGGGAGCTAAGTGGAACTGATGATCTCGAGATCATCAGTTCCACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-1614s21c1
Sequence:CCGGCTCGTCTGCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGCAGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-644s21c1
Sequence:CCGGTTAGCCTTCCTGCTCCAAGAACTCGAGTTCTTGGAGCAGGAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-338s21c1
Sequence:CCGGTGCTGACCCTGTGACTGATCTCTCGAGAGATCAGTCACAGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146012.2-392s21c1
Sequence:CCGGGTTCCGAGAGGCTTGTGTGTTCTCGAGAACACACAAGCCTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks