EMAIL THIS PAGE TO A FRIEND

CTDSPL2

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2

228 Gene Product Result for
Synonyms: HSPC129
Gene ID:
Mouse(329506) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Rat(311368) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
chicken(415574) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
dog(487531) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
cow(540232) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Horse(100056113) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
domestic cat(101094184) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
sheep(101120412) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
domestic guinea pig(100719531) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
naked mole-rat(101703442) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_212450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016396 Rosetta Predictions human pricing
NM_001014048 Rosetta Predictions rat pricing
NM_212450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206991 predicted 1323
2 SASI_Hs01_00206992 predicted 967
3 SASI_Hs01_00206993 predicted 1467
4 SASI_Hs01_00206994 predicted 1669
5 SASI_Hs02_00349404 predicted 1473
6 SASI_Hs01_00206995 predicted 1030
7 SASI_Hs01_00206996 predicted 631
8 SASI_Hs01_00206997 predicted 1780
9 SASI_Hs01_00206998 predicted 1293
10 SASI_Hs01_00206999 predicted 1745
11 SASI_Hs01_00207000 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063795 predicted 313
2 SASI_Rn01_00063796 predicted 1354
3 SASI_Rn01_00063797 predicted 710
4 SASI_Rn01_00063798 predicted 1148
5 SASI_Rn01_00063799 predicted 317
6 SASI_Rn01_00063800 predicted 377
7 SASI_Rn02_00201440 predicted 1164
8 SASI_Rn01_00063801 predicted 1142
9 SASI_Rn01_00063803 predicted 753
10 SASI_Rn01_00063804 predicted 1059
11 SASI_Rn01_00063802 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144275 predicted 1334
2 SASI_Mm02_00352270 predicted 396
3 SASI_Mm01_00144277 predicted 1444
4 SASI_Mm02_00352271 predicted 383
5 SASI_Mm01_00144278 predicted 1239
6 SASI_Mm02_00352272 predicted 461
7 SASI_Mm01_00144280 predicted 1657
8 SASI_Mm01_00144281 predicted 1234
9 SASI_Mm01_00144282 predicted 1136
10 SASI_Mm02_00352273 predicted 1434
11 SASI_Mm01_00144274 predicted 1061
12 SASI_Mm01_00144276 predicted 1553
13 SASI_Mm01_00144279 predicted 1257
14 SASI_Mm01_00144283 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016396
CTDSPL2 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-295s1c1
Sequence:CCGGGAAGAATGAAACCGGCTTGTTCTCGAGAACAAGCCGGTTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1217s1c1
Sequence:CCGGGCTTCTAAGAAGGTGTATGCACTCGAGTGCATACACCTTCTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1408s1c1
Sequence:CCGGGCTTTCTAATGGAATCCCTATCTCGAGATAGGGATTCCATTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1174s1c1
Sequence:CCGGCCTGGAACGAATGTCTCAGATCTCGAGATCTGAGACATTCGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016396.1-2595s1c1
Sequence:CCGGGCTCTCAGTTACAATCAATTTCTCGAGAAATTGATTGTAACTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2404s1c1
Sequence:CCGGGCACACAGATTTAATGGATAACTCGAGTTATCCATTAAATCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-764s1c1
Sequence:CCGGGCTTACTCAAATCAAGCAGTTCTCGAGAACTGCTTGATTTGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1409s1c1
Sequence:CCGGCTTTCTAATGGAATCCCTATACTCGAGTATAGGGATTCCATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-380s1c1
Sequence:CCGGCGGAGTAGAATTGAACGTGATCTCGAGATCACGTTCAATTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2448s1c1
Sequence:CCGGGCTCACAATCTTTGAGGAGAACTCGAGTTCTCCTCAAAGATTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016396
CTDSPL2 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-295s1c1
Sequence:CCGGGAAGAATGAAACCGGCTTGTTCTCGAGAACAAGCCGGTTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1217s1c1
Sequence:CCGGGCTTCTAAGAAGGTGTATGCACTCGAGTGCATACACCTTCTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1408s1c1
Sequence:CCGGGCTTTCTAATGGAATCCCTATCTCGAGATAGGGATTCCATTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1174s1c1
Sequence:CCGGCCTGGAACGAATGTCTCAGATCTCGAGATCTGAGACATTCGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016396.1-2595s1c1
Sequence:CCGGGCTCTCAGTTACAATCAATTTCTCGAGAAATTGATTGTAACTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2404s1c1
Sequence:CCGGGCACACAGATTTAATGGATAACTCGAGTTATCCATTAAATCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-764s1c1
Sequence:CCGGGCTTACTCAAATCAAGCAGTTCTCGAGAACTGCTTGATTTGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1409s1c1
Sequence:CCGGCTTTCTAATGGAATCCCTATACTCGAGTATAGGGATTCCATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-380s1c1
Sequence:CCGGCGGAGTAGAATTGAACGTGATCTCGAGATCACGTTCAATTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2448s1c1
Sequence:CCGGGCTCACAATCTTTGAGGAGAACTCGAGTTCTCCTCAAAGATTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016396
CTDSPL2 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-295s1c1
Sequence:CCGGGAAGAATGAAACCGGCTTGTTCTCGAGAACAAGCCGGTTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1217s1c1
Sequence:CCGGGCTTCTAAGAAGGTGTATGCACTCGAGTGCATACACCTTCTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1408s1c1
Sequence:CCGGGCTTTCTAATGGAATCCCTATCTCGAGATAGGGATTCCATTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-1174s1c1
Sequence:CCGGCCTGGAACGAATGTCTCAGATCTCGAGATCTGAGACATTCGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016396.1-2595s1c1
Sequence:CCGGGCTCTCAGTTACAATCAATTTCTCGAGAAATTGATTGTAACTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2404s1c1
Sequence:CCGGGCACACAGATTTAATGGATAACTCGAGTTATCCATTAAATCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-764s1c1
Sequence:CCGGGCTTACTCAAATCAAGCAGTTCTCGAGAACTGCTTGATTTGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016396.1-1409s1c1
Sequence:CCGGCTTTCTAATGGAATCCCTATACTCGAGTATAGGGATTCCATTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016396.1-380s1c1
Sequence:CCGGCGGAGTAGAATTGAACGTGATCTCGAGATCACGTTCAATTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016396.1-2448s1c1
Sequence:CCGGGCTCACAATCTTTGAGGAGAACTCGAGTTCTCCTCAAAGATTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212450
VALIDATED
CTDSPL2 MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.1-704s1c1
Sequence:CCGGGCTGAGGAGATAGTGAAACAACTCGAGTTGTTTCACTATCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212450.1-1718s1c1
Sequence:CCGGGCCCAATAATAATCAAGGGTTCTCGAGAACCCTTGATTATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-1552s1c1
Sequence:CCGGCAGATTTCGATTGCATGATTTCTCGAGAAATCATGCAATCGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-2608s1c1
Sequence:CCGGGCTCCCAGTTACAATCAGTTTCTCGAGAAACTGATTGTAACTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-811s1c1
Sequence:CCGGGCCATCACTAAATAATGGTTTCTCGAGAAACCATTATTTAGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212450.1-1208s1c1
Sequence:CCGGCAGATGTATGAGATCATTCTTCTCGAGAAGAATGATCTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-328s1c1
Sequence:CCGGGGCTTATTGTCTTCAATTAAACTCGAGTTTAATTGAAGACAATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1440s1c1
Sequence:CCGGCCCTATAGAAAGCTGGTTTATCTCGAGATAAACCAGCTTTCTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1328s1c1
Sequence:CCGGGTGTACAAGGAAACTATATAACTCGAGTTATATAGTTTCCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212450
VALIDATED
CTDSPL2 MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.1-704s1c1
Sequence:CCGGGCTGAGGAGATAGTGAAACAACTCGAGTTGTTTCACTATCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212450.1-1718s1c1
Sequence:CCGGGCCCAATAATAATCAAGGGTTCTCGAGAACCCTTGATTATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-1552s1c1
Sequence:CCGGCAGATTTCGATTGCATGATTTCTCGAGAAATCATGCAATCGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-2608s1c1
Sequence:CCGGGCTCCCAGTTACAATCAGTTTCTCGAGAAACTGATTGTAACTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-811s1c1
Sequence:CCGGGCCATCACTAAATAATGGTTTCTCGAGAAACCATTATTTAGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212450.1-1208s1c1
Sequence:CCGGCAGATGTATGAGATCATTCTTCTCGAGAAGAATGATCTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-328s1c1
Sequence:CCGGGGCTTATTGTCTTCAATTAAACTCGAGTTTAATTGAAGACAATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1440s1c1
Sequence:CCGGCCCTATAGAAAGCTGGTTTATCTCGAGATAAACCAGCTTTCTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1328s1c1
Sequence:CCGGGTGTACAAGGAAACTATATAACTCGAGTTATATAGTTTCCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212450
VALIDATED
CTDSPL2 MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.1-704s1c1
Sequence:CCGGGCTGAGGAGATAGTGAAACAACTCGAGTTGTTTCACTATCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212450.1-1718s1c1
Sequence:CCGGGCCCAATAATAATCAAGGGTTCTCGAGAACCCTTGATTATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-1552s1c1
Sequence:CCGGCAGATTTCGATTGCATGATTTCTCGAGAAATCATGCAATCGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-2608s1c1
Sequence:CCGGGCTCCCAGTTACAATCAGTTTCTCGAGAAACTGATTGTAACTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212450.1-811s1c1
Sequence:CCGGGCCATCACTAAATAATGGTTTCTCGAGAAACCATTATTTAGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212450.1-1208s1c1
Sequence:CCGGCAGATGTATGAGATCATTCTTCTCGAGAAGAATGATCTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-328s1c1
Sequence:CCGGGGCTTATTGTCTTCAATTAAACTCGAGTTTAATTGAAGACAATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1440s1c1
Sequence:CCGGCCCTATAGAAAGCTGGTTTATCTCGAGATAAACCAGCTTTCTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212450.3-1328s1c1
Sequence:CCGGGTGTACAAGGAAACTATATAACTCGAGTTATATAGTTTCCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks