EMAIL THIS PAGE TO A FRIEND

CTDSPL

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like

258 Gene Product Result for
Synonyms: C3orf8 HYA22 PSR1 RBSP3 SCP3
UniProtKB ID: O15194, Q3ZTU0, Q70KI4, Q7Z5Q2
Gene ID:
Mouse(69274) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Rat(301056) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
naked mole-rat(101716067) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
domestic guinea pig(100716384) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
sheep(101114730) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
chicken(408252) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
cow(538425) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
domestic cat(101090544) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
dog(608986) CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008392 Rosetta Predictions human pricing
NM_005808 Rosetta Predictions human pricing
NM_001106865 Rosetta Predictions rat pricing
NM_133710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050481 predicted 383
2 SASI_Hs01_00050482 predicted 360
3 SASI_Hs01_00050483 predicted 384
4 SASI_Hs01_00050484 predicted 390
5 SASI_Hs01_00050485 predicted 386
6 SASI_Hs01_00050486 predicted 294
7 SASI_Hs01_00050487 predicted 343
8 SASI_Hs02_00305422 predicted 375
9 SASI_Hs02_00305423 predicted 1328
10 SASI_Hs01_00050489 predicted 667
11 SASI_Hs01_00050480 predicted 971
12 SASI_Hs01_00050488 predicted 93
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340324 predicted 936
2 SASI_Hs01_00193547 predicted 344
3 SASI_Hs01_00193548 predicted 333
4 SASI_Hs01_00193549 predicted 352
5 SASI_Hs01_00193550 predicted 260
6 SASI_Hs02_00340325 predicted 355
7 SASI_Hs01_00193551 predicted 308
8 SASI_Hs01_00193552 predicted 244
9 SASI_Hs01_00193553 predicted 334
10 SASI_Hs01_00193556 predicted 638
11 SASI_Hs01_00193554 predicted 1298
12 SASI_Hs01_00193555 predicted 96
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223166 predicted 570
2 SASI_Rn02_00223167 predicted 570
3 SASI_Rn02_00223168 predicted 523
4 SASI_Rn02_00223169 predicted 1234
5 SASI_Rn02_00223170 predicted 1158
6 SASI_Rn02_00223171 predicted 642
7 SASI_Rn02_00223172 predicted 1169
8 SASI_Rn02_00223173 predicted 640
9 SASI_Rn02_00223174 predicted 851
10 SASI_Rn02_00223175 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115070 predicted 684
2 SASI_Mm01_00115071 predicted 705
3 SASI_Mm01_00115072 predicted 913
4 SASI_Mm01_00115073 predicted 759
5 SASI_Mm01_00115074 predicted 970
6 SASI_Mm01_00115075 predicted 1043
7 SASI_Mm01_00115076 predicted 687
8 SASI_Mm01_00115077 predicted 647
9 SASI_Mm01_00115078 predicted 579
10 SASI_Mm01_00115079 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005808
VALIDATED
CTDSPL MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-307s21c1
Sequence:GTACCGGGAAATGTGTGGTCATTGATTTCTCGAGAAATCAATGACCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-160s21c1
Sequence:CCGGCTTCTGCTGCTTCCGTGATTACTCGAGTAATCACGGAAGCAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-1312s21c1
Sequence:CCGGAGAAGATGAACATGACAATTTCTCGAGAAATTGTCATGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-630s21c1
Sequence:CCGGAGCTGAGCAAAGTGATCATTGCTCGAGCAATGATCACTTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-343s21c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-795s21c1
Sequence:GTACCGGTGCTGCACAGACTCTGCAATACTCGAGTATTGCAGAGTCTGTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-285s21c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-635s1c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-693s1c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005808.x-1012s1c1
Sequence:CCGGCCTGCCTCATACATCTTCCATCTCGAGATGGAAGATGTATGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-456s1c1
Sequence:CCGGCCAGTGCAACGTCAGCTTAAACTCGAGTTTAAGCTGACGTTGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005808.x-3551s1c1
Sequence:CCGGCCCTTGAATCTGCTTTATGTACTCGAGTACATAAAGCAGATTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005808
VALIDATED
CTDSPL MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-307s21c1
Sequence:GTACCGGGAAATGTGTGGTCATTGATTTCTCGAGAAATCAATGACCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-160s21c1
Sequence:CCGGCTTCTGCTGCTTCCGTGATTACTCGAGTAATCACGGAAGCAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-1312s21c1
Sequence:CCGGAGAAGATGAACATGACAATTTCTCGAGAAATTGTCATGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-630s21c1
Sequence:CCGGAGCTGAGCAAAGTGATCATTGCTCGAGCAATGATCACTTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-343s21c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-795s21c1
Sequence:GTACCGGTGCTGCACAGACTCTGCAATACTCGAGTATTGCAGAGTCTGTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-285s21c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-635s1c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-693s1c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005808.x-1012s1c1
Sequence:CCGGCCTGCCTCATACATCTTCCATCTCGAGATGGAAGATGTATGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-456s1c1
Sequence:CCGGCCAGTGCAACGTCAGCTTAAACTCGAGTTTAAGCTGACGTTGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005808.x-3551s1c1
Sequence:CCGGCCCTTGAATCTGCTTTATGTACTCGAGTACATAAAGCAGATTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005808
VALIDATED
CTDSPL MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-307s21c1
Sequence:GTACCGGGAAATGTGTGGTCATTGATTTCTCGAGAAATCAATGACCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-160s21c1
Sequence:CCGGCTTCTGCTGCTTCCGTGATTACTCGAGTAATCACGGAAGCAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-1312s21c1
Sequence:CCGGAGAAGATGAACATGACAATTTCTCGAGAAATTGTCATGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-630s21c1
Sequence:CCGGAGCTGAGCAAAGTGATCATTGCTCGAGCAATGATCACTTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-343s21c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005808.2-795s21c1
Sequence:GTACCGGTGCTGCACAGACTCTGCAATACTCGAGTATTGCAGAGTCTGTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005808.2-285s21c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-635s1c1
Sequence:CCGGTGACGGTGCTTGACTATGGAACTCGAGTTCCATAGTCAAGCACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-693s1c1
Sequence:CCGGGCACAGTTCGTTTAAGCCTATCTCGAGATAGGCTTAAACGAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005808.x-1012s1c1
Sequence:CCGGCCTGCCTCATACATCTTCCATCTCGAGATGGAAGATGTATGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005808.x-456s1c1
Sequence:CCGGCCAGTGCAACGTCAGCTTAAACTCGAGTTTAAGCTGACGTTGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005808.x-3551s1c1
Sequence:CCGGCCCTTGAATCTGCTTTATGTACTCGAGTACATAAAGCAGATTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133710
VALIDATED
CTDSPL MISSION shRNA Bacterial Glycerol Stock
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-587s21c1
Sequence:CCGGACCAAGCCCACCAGCTAAATACTCGAGTATTTAGCTGGTGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-977s21c1
Sequence:CCGGAGTGATCATCGTGGACAATTCCTCGAGGAATTGTCCACGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133710.3-411s21c1
Sequence:CCGGCAGCGCAACATCAGCCTAAAGCTCGAGCTTTAGGCTGATGTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-1656s21c1
Sequence:CCGGTTTACGGTCTTAGATACTTACCTCGAGGTAAGTATCTAAGACCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-695s21c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-984s1c1
Sequence:CCGGCTTCAGAGAATCCTGCGTGTTCTCGAGAACACGCAGGATTCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133710.1-2506s1c1
Sequence:CCGGGCAGTCAACATCAGAGCCTAACTCGAGTTAGGCTCTGATGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-777s1c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-676s1c1
Sequence:CCGGCCACCAGCTAAATACCTCCTTCTCGAGAAGGAGGTATTTAGCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-492s1c1
Sequence:CCGGCCAGCGCAACATCAGCCTAAACTCGAGTTTAGGCTGATGTTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133710
VALIDATED
CTDSPL MISSION shRNA shRNA Plasmid DNA
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-587s21c1
Sequence:CCGGACCAAGCCCACCAGCTAAATACTCGAGTATTTAGCTGGTGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-977s21c1
Sequence:CCGGAGTGATCATCGTGGACAATTCCTCGAGGAATTGTCCACGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133710.3-411s21c1
Sequence:CCGGCAGCGCAACATCAGCCTAAAGCTCGAGCTTTAGGCTGATGTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-1656s21c1
Sequence:CCGGTTTACGGTCTTAGATACTTACCTCGAGGTAAGTATCTAAGACCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-695s21c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-984s1c1
Sequence:CCGGCTTCAGAGAATCCTGCGTGTTCTCGAGAACACGCAGGATTCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133710.1-2506s1c1
Sequence:CCGGGCAGTCAACATCAGAGCCTAACTCGAGTTAGGCTCTGATGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-777s1c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-676s1c1
Sequence:CCGGCCACCAGCTAAATACCTCCTTCTCGAGAAGGAGGTATTTAGCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-492s1c1
Sequence:CCGGCCAGCGCAACATCAGCCTAAACTCGAGTTTAGGCTGATGTTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133710
VALIDATED
CTDSPL MISSION shRNA Lentiviral Transduction Particles
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-587s21c1
Sequence:CCGGACCAAGCCCACCAGCTAAATACTCGAGTATTTAGCTGGTGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-977s21c1
Sequence:CCGGAGTGATCATCGTGGACAATTCCTCGAGGAATTGTCCACGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133710.3-411s21c1
Sequence:CCGGCAGCGCAACATCAGCCTAAAGCTCGAGCTTTAGGCTGATGTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-1656s21c1
Sequence:CCGGTTTACGGTCTTAGATACTTACCTCGAGGTAAGTATCTAAGACCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133710.3-695s21c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-984s1c1
Sequence:CCGGCTTCAGAGAATCCTGCGTGTTCTCGAGAACACGCAGGATTCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133710.1-2506s1c1
Sequence:CCGGGCAGTCAACATCAGAGCCTAACTCGAGTTAGGCTCTGATGTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133710.1-777s1c1
Sequence:CCGGGCCCATTAGTAATGCTGACTTCTCGAGAAGTCAGCATTACTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-676s1c1
Sequence:CCGGCCACCAGCTAAATACCTCCTTCTCGAGAAGGAGGTATTTAGCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133710.1-492s1c1
Sequence:CCGGCCAGCGCAACATCAGCCTAAACTCGAGTTTAGGCTGATGTTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks