EMAIL THIS PAGE TO A FRIEND

CTF1

cardiotrophin 1

56 Gene Product Result for
Synonyms: CT-1 CT1
UniProtKB ID: Q16619, A8MVX4, Q5U5Y7
Gene ID:
Human(1489) Summary: The protein encoded by this gene is a secreted cytokine that induces cardiac myocyte hypertrophy in vitro. It has been shown to bind and activate the ILST/gp130 receoptor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(13019) cardiotrophin 1
Rat(29201) cardiotrophin 1
sheep(101104201) cardiotrophin 1
naked mole-rat(101703771) cardiotrophin 1
dog(403821) cardiotrophin 1
cow(514803) cardiotrophin 1
domestic cat(101083642) cardiotrophin 1
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006121 MISSION® esiRNA esiRNA targeting mouse Ctf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001330 Rosetta Predictions human pricing
NM_017129 Rosetta Predictions rat pricing
NM_007795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331637 predicted 719
2 SASI_Hs01_00076792 predicted 732
3 SASI_Hs01_00076793 predicted 1131
4 SASI_Hs01_00076794 predicted 69
5 SASI_Hs01_00076795 predicted 108
6 SASI_Hs01_00076796 predicted 752
7 SASI_Hs01_00076797 predicted 1286
8 SASI_Hs01_00076799 predicted 1305
9 SASI_Hs01_00076801 predicted 1407
10 SASI_Hs02_00331638 predicted 1252
11 SASI_Hs01_00076798 predicted 1496
12 SASI_Hs01_00076800 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058418 predicted 510
2 SASI_Rn01_00058419 predicted 577
3 SASI_Rn01_00058420 predicted 632
4 SASI_Rn01_00058421 predicted 540
5 SASI_Rn01_00058422 predicted 642
6 SASI_Rn01_00058423 predicted 529
7 SASI_Rn01_00058424 predicted 527
8 SASI_Rn01_00058425 predicted 327
9 SASI_Rn01_00058426 predicted 376
10 SASI_Rn01_00058427 predicted 64
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146031 predicted 477
2 SASI_Mm01_00146032 predicted 490
3 SASI_Mm01_00146033 predicted 326
4 SASI_Mm01_00146034 predicted 502
5 SASI_Mm01_00146035 predicted 416
6 SASI_Mm02_00312483 predicted 325
7 SASI_Mm01_00146037 predicted 266
8 SASI_Mm02_00312484 predicted 491
9 SASI_Mm01_00146038 predicted 303
10 SASI_Mm01_00146039 predicted 411
11 SASI_Mm01_00146036 predicted 412
12 SASI_Mm01_00146040 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001330
CTF1 MISSION shRNA Bacterial Glycerol Stock
cardiotrophin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-147s21c1
Sequence:CCGGTCACCAAATACGCTGAGCAGCCTCGAGGCTGCTCAGCGTATTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-161s21c1
Sequence:CCGGGAGCAGCTGCTCCAGGAATATCTCGAGATATTCCTGGAGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-727s21c1
Sequence:CCGGTGTCTGTCTGTCTGCTCTTAGCTCGAGCTAAGAGCAGACAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-686s21c1
Sequence:CCGGGTCTCTCCTTCCGCTTCTTTGCTCGAGCAAAGAAGCGGAAGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-77s1c1
Sequence:CCGGGATTCCTCAGTCTCACTTCTTCTCGAGAAGAAGTGAGACTGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-69s1c1
Sequence:CCGGCCCAGACTGATTCCTCAGTCTCTCGAGAGACTGAGGAATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-107s1c1
Sequence:CCGGGAGGCCAAGATCCGTCAGACACTCGAGTGTCTGACGGATCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-134s1c1
Sequence:CCGGCTTGCGCACCTCCTCACCAAACTCGAGTTTGGTGAGGAGGTGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-559s1c1
Sequence:CCGGGCTCCGCGTTTGCGGCCTCTACTCGAGTAGAGGCCGCAAACGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001330
CTF1 MISSION shRNA shRNA Plasmid DNA
cardiotrophin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-147s21c1
Sequence:CCGGTCACCAAATACGCTGAGCAGCCTCGAGGCTGCTCAGCGTATTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-161s21c1
Sequence:CCGGGAGCAGCTGCTCCAGGAATATCTCGAGATATTCCTGGAGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-727s21c1
Sequence:CCGGTGTCTGTCTGTCTGCTCTTAGCTCGAGCTAAGAGCAGACAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-686s21c1
Sequence:CCGGGTCTCTCCTTCCGCTTCTTTGCTCGAGCAAAGAAGCGGAAGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-77s1c1
Sequence:CCGGGATTCCTCAGTCTCACTTCTTCTCGAGAAGAAGTGAGACTGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-69s1c1
Sequence:CCGGCCCAGACTGATTCCTCAGTCTCTCGAGAGACTGAGGAATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-107s1c1
Sequence:CCGGGAGGCCAAGATCCGTCAGACACTCGAGTGTCTGACGGATCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-134s1c1
Sequence:CCGGCTTGCGCACCTCCTCACCAAACTCGAGTTTGGTGAGGAGGTGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-559s1c1
Sequence:CCGGGCTCCGCGTTTGCGGCCTCTACTCGAGTAGAGGCCGCAAACGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001330
CTF1 MISSION shRNA Lentiviral Transduction Particles
cardiotrophin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-147s21c1
Sequence:CCGGTCACCAAATACGCTGAGCAGCCTCGAGGCTGCTCAGCGTATTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001330.3-161s21c1
Sequence:CCGGGAGCAGCTGCTCCAGGAATATCTCGAGATATTCCTGGAGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-727s21c1
Sequence:CCGGTGTCTGTCTGTCTGCTCTTAGCTCGAGCTAAGAGCAGACAGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001330.3-686s21c1
Sequence:CCGGGTCTCTCCTTCCGCTTCTTTGCTCGAGCAAAGAAGCGGAAGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-77s1c1
Sequence:CCGGGATTCCTCAGTCTCACTTCTTCTCGAGAAGAAGTGAGACTGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-69s1c1
Sequence:CCGGCCCAGACTGATTCCTCAGTCTCTCGAGAGACTGAGGAATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-107s1c1
Sequence:CCGGGAGGCCAAGATCCGTCAGACACTCGAGTGTCTGACGGATCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-134s1c1
Sequence:CCGGCTTGCGCACCTCCTCACCAAACTCGAGTTTGGTGAGGAGGTGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001330.2-559s1c1
Sequence:CCGGGCTCCGCGTTTGCGGCCTCTACTCGAGTAGAGGCCGCAAACGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007795
VALIDATED
CTF1 MISSION shRNA Bacterial Glycerol Stock
cardiotrophin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-490s21c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-49s21c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-622s21c1
Sequence:CCGGCGTCGCCTGAGAGTGAATACTCTCGAGAGTATTCACTCTCAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-142s21c1
Sequence:CCGGAGAACAACTTCTGGAGGAATACTCGAGTATTCCTCCAGAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-717s21c1
Sequence:CCGGCTTGGGCTGTCCCTATCTTTCCTCGAGGAAAGATAGGGACAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-140s1c1
Sequence:CCGGGCAGAACAACTTCTGGAGGAACTCGAGTTCCTCCAGAAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-125s1c1
Sequence:CCGGCTCCTGACCAAATATGCAGAACTCGAGTTCTGCATATTTGGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-49s1c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-559s1c1
Sequence:CCGGCGGCCTCTATGGCGAGTGGGTCTCGAGACCCACTCGCCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-490s1c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007795
VALIDATED
CTF1 MISSION shRNA shRNA Plasmid DNA
cardiotrophin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-490s21c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-49s21c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-622s21c1
Sequence:CCGGCGTCGCCTGAGAGTGAATACTCTCGAGAGTATTCACTCTCAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-142s21c1
Sequence:CCGGAGAACAACTTCTGGAGGAATACTCGAGTATTCCTCCAGAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-717s21c1
Sequence:CCGGCTTGGGCTGTCCCTATCTTTCCTCGAGGAAAGATAGGGACAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-140s1c1
Sequence:CCGGGCAGAACAACTTCTGGAGGAACTCGAGTTCCTCCAGAAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-125s1c1
Sequence:CCGGCTCCTGACCAAATATGCAGAACTCGAGTTCTGCATATTTGGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-49s1c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-559s1c1
Sequence:CCGGCGGCCTCTATGGCGAGTGGGTCTCGAGACCCACTCGCCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-490s1c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007795
VALIDATED
CTF1 MISSION shRNA Lentiviral Transduction Particles
cardiotrophin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-490s21c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-49s21c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-622s21c1
Sequence:CCGGCGTCGCCTGAGAGTGAATACTCTCGAGAGTATTCACTCTCAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007795.1-142s21c1
Sequence:CCGGAGAACAACTTCTGGAGGAATACTCGAGTATTCCTCCAGAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007795.1-717s21c1
Sequence:CCGGCTTGGGCTGTCCCTATCTTTCCTCGAGGAAAGATAGGGACAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-140s1c1
Sequence:CCGGGCAGAACAACTTCTGGAGGAACTCGAGTTCCTCCAGAAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-125s1c1
Sequence:CCGGCTCCTGACCAAATATGCAGAACTCGAGTTCTGCATATTTGGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-49s1c1
Sequence:CCGGCCACCAGACTGACTCCTCAATCTCGAGATTGAGGAGTCAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007795.1-559s1c1
Sequence:CCGGCGGCCTCTATGGCGAGTGGGTCTCGAGACCCACTCGCCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007795.1-490s1c1
Sequence:CCGGCGCCACCCTCTTCACGGCCAACTCGAGTTGGCCGTGAAGAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks