EMAIL THIS PAGE TO A FRIEND

CTH

cystathionase (cystathionine gamma-lyase)

70 Gene Product Result for
Gene ID:
Human(1491) Summary: This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Mouse(107869) cystathionase (cystathionine gamma-lyase)
Rat(24962) cystathionase (cystathionine gamma-lyase)
Zebrafish(322055) cystathionase (cystathionine gamma-lyase)
chicken(424716) cystathionase (cystathionine gamma-lyase)
cow(539159) cystathionase (cystathionine gamma-lyase)
domestic cat(101083282) cystathionase (cystathionine gamma-lyase)
dog(479991) cystathionase (cystathionine gamma-lyase)
naked mole-rat(101718068) cystathionase (cystathionine gamma-lyase)
domestic guinea pig(100720299) cystathionase (cystathionine gamma-lyase)
sheep(101118487) cystathionase (cystathionine gamma-lyase)
Domestic Rabbit(100348407) cystathionase (cystathionine gamma-lyase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108594 Anti-CTH IgG fraction of antiserum human, zebrafish, horse, mouse, guinea pig, canine, pig, rabbit, human, rat
immunohistochemistry, western blot pricing
C8248 Anti-CTH (22-35) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C8373 Anti-CTH (293-305) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405673 Anti-CTH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV46068 Anti-CTH antibody produced in rabbit IgG fraction of antiserum human, rat, mouse, horse, zebrafish, rabbit, guinea pig, canine, pig
immunohistochemistry, western blot pricing
HPA021591 Anti-CTH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry pricing
HPA023300 Anti-CTH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
SAB2100501 Anti-CTH antibody produced in rabbit affinity isolated antibody canine, human, zebrafish, pig, mouse, rabbit, bovine, rat, guinea pig, horse
western blot pricing
WH0001491M1 Monoclonal Anti-CTH antibody produced in mouse clone 4E1-1B7, purified immunoglobulin, buffered aqueous solution mouse
pricing
SAB1403711 Monoclonal Anti-CTH antibody produced in mouse clone S51, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001902 Rosetta Predictions human pricing
NM_153742 Rosetta Predictions human pricing
NM_017074 Rosetta Predictions rat pricing
NM_145953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332775 predicted 1340
2 SASI_Hs01_00120732 predicted 1060
3 SASI_Hs02_00332776 predicted 958
4 SASI_Hs01_00120733 predicted 1472
5 SASI_Hs02_00332777 predicted 969
6 SASI_Hs01_00120734 predicted 1205
7 SASI_Hs01_00120735 predicted 1543
8 SASI_Hs01_00120736 predicted 1422
9 SASI_Hs01_00120737 predicted 1353
10 SASI_Hs01_00120740 predicted 982
11 SASI_Hs01_00120738 predicted 1191
12 SASI_Hs01_00120739 predicted 1199
13 SASI_Hs01_00120741 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367454 predicted 1209
2 SASI_Hs01_00191506 predicted 936
3 SASI_Hs02_00367455 predicted 826
4 SASI_Hs01_00191507 predicted 1338
5 SASI_Hs02_00367456 predicted 840
6 SASI_Hs01_00191508 predicted 1070
7 SASI_Hs01_00191509 predicted 1418
8 SASI_Hs01_00191510 predicted 1290
9 SASI_Hs01_00191511 predicted 1225
10 SASI_Hs01_00191514 predicted 844
11 SASI_Hs01_00191512 predicted 1059
12 SASI_Hs01_00191513 predicted 1062
13 SASI_Hs01_00191515 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030344 predicted 707
2 SASI_Rn01_00030345 predicted 564
3 SASI_Rn01_00030346 predicted 663
4 SASI_Rn01_00030347 predicted 385
5 SASI_Rn01_00030348 predicted 522
6 SASI_Rn01_00030349 predicted 1128
7 SASI_Rn01_00030350 predicted 1198
8 SASI_Rn01_00030351 predicted 680
9 SASI_Rn01_00030352 predicted 735
10 SASI_Rn02_00261284 predicted 620
11 SASI_Rn01_00030353 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040350 predicted 679
2 SASI_Mm01_00040351 predicted 464
3 SASI_Mm01_00040352 predicted 457
4 SASI_Mm01_00040353 predicted 1132
5 SASI_Mm01_00040354 predicted 274
6 SASI_Mm01_00040355 predicted 402
7 SASI_Mm01_00040356 predicted 1308
8 SASI_Mm01_00040357 predicted 307
9 SASI_Mm01_00040358 predicted 555
10 SASI_Mm01_00040359 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145953
CTH MISSION shRNA Bacterial Glycerol Stock
cystathionase (cystathionine gamma-lyase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-626s21c1
Sequence:CCGGTGGCTCTGGGTGCTGATATTTCTCGAGAAATATCAGCACCCAGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1440s21c1
Sequence:CCGGGTTAGTATCATTTCGGTAATTCTCGAGAATTACCGAAATGATACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-534s21c1
Sequence:CCGGCATTGGAGCCTGCGCACAAATCTCGAGATTTGTGCGCAGGCTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1298s21c1
Sequence:CCGGGAATAACTGGACAGATCATTACTCGAGTAATGATCTGTCCAGTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-594s21c1
Sequence:CCGGCACCTTCATGTCTGCATATTTCTCGAGAAATATGCAGACATGAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145953.2-1463s1c1
Sequence:CCGGGCTATATTTGTGTCCAAGGAACTCGAGTTCCTTGGACACAAATATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-1131s1c1
Sequence:CCGGCGGGATCAATGACACACTGATCTCGAGATCAGTGTGTCATTGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-723s1c1
Sequence:CCGGCCTCAATAGTCGGCTTCGTTTCTCGAGAAACGAAGCCGACTATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-162s1c1
Sequence:CCGGCACCACATTTAAGCAGGACTTCTCGAGAAGTCCTGCTTAAATGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-311s1c1
Sequence:CCGGCCATTACGATTACCCATCTTTCTCGAGAAAGATGGGTAATCGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145953
CTH MISSION shRNA shRNA Plasmid DNA
cystathionase (cystathionine gamma-lyase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-626s21c1
Sequence:CCGGTGGCTCTGGGTGCTGATATTTCTCGAGAAATATCAGCACCCAGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1440s21c1
Sequence:CCGGGTTAGTATCATTTCGGTAATTCTCGAGAATTACCGAAATGATACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-534s21c1
Sequence:CCGGCATTGGAGCCTGCGCACAAATCTCGAGATTTGTGCGCAGGCTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1298s21c1
Sequence:CCGGGAATAACTGGACAGATCATTACTCGAGTAATGATCTGTCCAGTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-594s21c1
Sequence:CCGGCACCTTCATGTCTGCATATTTCTCGAGAAATATGCAGACATGAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145953.2-1463s1c1
Sequence:CCGGGCTATATTTGTGTCCAAGGAACTCGAGTTCCTTGGACACAAATATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-1131s1c1
Sequence:CCGGCGGGATCAATGACACACTGATCTCGAGATCAGTGTGTCATTGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-723s1c1
Sequence:CCGGCCTCAATAGTCGGCTTCGTTTCTCGAGAAACGAAGCCGACTATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-162s1c1
Sequence:CCGGCACCACATTTAAGCAGGACTTCTCGAGAAGTCCTGCTTAAATGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-311s1c1
Sequence:CCGGCCATTACGATTACCCATCTTTCTCGAGAAAGATGGGTAATCGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145953
CTH MISSION shRNA Lentiviral Transduction Particles
cystathionase (cystathionine gamma-lyase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-626s21c1
Sequence:CCGGTGGCTCTGGGTGCTGATATTTCTCGAGAAATATCAGCACCCAGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1440s21c1
Sequence:CCGGGTTAGTATCATTTCGGTAATTCTCGAGAATTACCGAAATGATACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-534s21c1
Sequence:CCGGCATTGGAGCCTGCGCACAAATCTCGAGATTTGTGCGCAGGCTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145953.2-1298s21c1
Sequence:CCGGGAATAACTGGACAGATCATTACTCGAGTAATGATCTGTCCAGTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145953.2-594s21c1
Sequence:CCGGCACCTTCATGTCTGCATATTTCTCGAGAAATATGCAGACATGAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145953.2-1463s1c1
Sequence:CCGGGCTATATTTGTGTCCAAGGAACTCGAGTTCCTTGGACACAAATATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-1131s1c1
Sequence:CCGGCGGGATCAATGACACACTGATCTCGAGATCAGTGTGTCATTGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-723s1c1
Sequence:CCGGCCTCAATAGTCGGCTTCGTTTCTCGAGAAACGAAGCCGACTATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-162s1c1
Sequence:CCGGCACCACATTTAAGCAGGACTTCTCGAGAAGTCCTGCTTAAATGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145953.2-311s1c1
Sequence:CCGGCCATTACGATTACCCATCTTTCTCGAGAAAGATGGGTAATCGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001902
VALIDATED
CTH MISSION shRNA Bacterial Glycerol Stock
cystathionase (cystathionine gamma-lyase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1549s21c1
Sequence:CCGGATTACAGGTCAATTCTGTTAACTCGAGTTAACAGAATTGACCTGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-973s1c2
Sequence:CCGGGCCCAGTTCCTGGAATCTAATCTCGAGATTAGATTCCAGGAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1401s21c1
Sequence:CCGGATCAAATCTTCCTGAGTAATTCTCGAGAATTACTCAGGAAGATTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1347s21c1
Sequence:CCGGTGGAAGTCACAGCTAGTATTCCTCGAGGAATACTAGCTGTGACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1130s21c1
Sequence:CCGGTCAAGAACCTAAAGCTATTTACTCGAGTAAATAGCTTTAGGTTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1621s21c1
Sequence:CCGGGTGCTACTTTGGGAGATTATGCTCGAGCATAATCTCCCAAAGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-1472s1c1
Sequence:CCGGGCACCTCATTATCTTTCATAACTCGAGTTATGAAAGATAATGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001902.4-837s1c1
Sequence:CCGGCCTTCATAATAGACTTCGTTTCTCGAGAAACGAAGTCTATTATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-836s1c1
Sequence:CCGGGCCTTCATAATAGACTTCGTTCTCGAGAACGAAGTCTATTATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-341s1c1
Sequence:CCGGCCACTAGGAATTGCCTTGAAACTCGAGTTTCAAGGCAATTCCTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001902
VALIDATED
CTH MISSION shRNA shRNA Plasmid DNA
cystathionase (cystathionine gamma-lyase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1549s21c1
Sequence:CCGGATTACAGGTCAATTCTGTTAACTCGAGTTAACAGAATTGACCTGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-973s1c2
Sequence:CCGGGCCCAGTTCCTGGAATCTAATCTCGAGATTAGATTCCAGGAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1401s21c1
Sequence:CCGGATCAAATCTTCCTGAGTAATTCTCGAGAATTACTCAGGAAGATTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1347s21c1
Sequence:CCGGTGGAAGTCACAGCTAGTATTCCTCGAGGAATACTAGCTGTGACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1130s21c1
Sequence:CCGGTCAAGAACCTAAAGCTATTTACTCGAGTAAATAGCTTTAGGTTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1621s21c1
Sequence:CCGGGTGCTACTTTGGGAGATTATGCTCGAGCATAATCTCCCAAAGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-1472s1c1
Sequence:CCGGGCACCTCATTATCTTTCATAACTCGAGTTATGAAAGATAATGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001902.4-837s1c1
Sequence:CCGGCCTTCATAATAGACTTCGTTTCTCGAGAAACGAAGTCTATTATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-836s1c1
Sequence:CCGGGCCTTCATAATAGACTTCGTTCTCGAGAACGAAGTCTATTATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-341s1c1
Sequence:CCGGCCACTAGGAATTGCCTTGAAACTCGAGTTTCAAGGCAATTCCTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001902
VALIDATED
CTH MISSION shRNA Lentiviral Transduction Particles
cystathionase (cystathionine gamma-lyase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1549s21c1
Sequence:CCGGATTACAGGTCAATTCTGTTAACTCGAGTTAACAGAATTGACCTGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-973s1c2
Sequence:CCGGGCCCAGTTCCTGGAATCTAATCTCGAGATTAGATTCCAGGAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1401s21c1
Sequence:CCGGATCAAATCTTCCTGAGTAATTCTCGAGAATTACTCAGGAAGATTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1347s21c1
Sequence:CCGGTGGAAGTCACAGCTAGTATTCCTCGAGGAATACTAGCTGTGACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001902.4-1130s21c1
Sequence:CCGGTCAAGAACCTAAAGCTATTTACTCGAGTAAATAGCTTTAGGTTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001902.4-1621s21c1
Sequence:CCGGGTGCTACTTTGGGAGATTATGCTCGAGCATAATCTCCCAAAGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-1472s1c1
Sequence:CCGGGCACCTCATTATCTTTCATAACTCGAGTTATGAAAGATAATGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001902.4-837s1c1
Sequence:CCGGCCTTCATAATAGACTTCGTTTCTCGAGAAACGAAGTCTATTATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-836s1c1
Sequence:CCGGGCCTTCATAATAGACTTCGTTCTCGAGAACGAAGTCTATTATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001902.4-341s1c1
Sequence:CCGGCCACTAGGAATTGCCTTGAAACTCGAGTTTCAAGGCAATTCCTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)