EMAIL THIS PAGE TO A FRIEND

CTHRC1

collagen triple helix repeat containing 1

66 Gene Product Result for
UniProtKB ID: Q96CG8, G3V141, Q6UW91, Q8IX63
Gene ID:
Human(115908) Summary: This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Mouse(68588) collagen triple helix repeat containing 1
Rat(282836) collagen triple helix repeat containing 1
chicken(420262) collagen triple helix repeat containing 1
domestic cat(101080261) collagen triple helix repeat containing 1
cow(538634) collagen triple helix repeat containing 1
sheep(101121943) collagen triple helix repeat containing 1
domestic guinea pig(100719188) collagen triple helix repeat containing 1
naked mole-rat(101723358) collagen triple helix repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138455 Rosetta Predictions human pricing
NM_172333 Rosetta Predictions rat pricing
NM_026778 Rosetta Predictions mouse pricing
XM_128002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363625 predicted 689
2 SASI_Hs01_00024087 predicted 645
3 SASI_Hs01_00024088 predicted 485
4 SASI_Hs02_00363626 predicted 600
5 SASI_Hs01_00024089 predicted 334
6 SASI_Hs01_00024090 predicted 556
7 SASI_Hs01_00024091 predicted 768
8 SASI_Hs01_00024092 predicted 563
9 SASI_Hs01_00024093 predicted 557
10 SASI_Hs02_00363627 predicted 549
11 SASI_Hs01_00024084 predicted 471
12 SASI_Hs01_00024085 predicted 499
13 SASI_Hs01_00024086 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047553 predicted 985
2 SASI_Rn02_00269224 predicted 443
3 SASI_Rn01_00047554 predicted 937
4 SASI_Rn01_00047556 predicted 666
5 SASI_Rn01_00047557 predicted 631
6 SASI_Rn01_00047558 predicted 673
7 SASI_Rn01_00047559 predicted 493
8 SASI_Rn01_00047560 predicted 555
9 SASI_Rn01_00047561 predicted 876
10 SASI_Rn01_00047562 predicted 792
11 SASI_Rn01_00047555 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330854 predicted 753
2 SASI_Mm02_00330855 predicted 787
3 SASI_Mm02_00330856 predicted 224
4 SASI_Mm02_00330857 predicted 218
5 SASI_Mm02_00330858 predicted 621
6 SASI_Mm02_00330859 predicted 446
7 SASI_Mm02_00330860 predicted 527
8 SASI_Mm02_00330861 predicted 686
9 SASI_Mm02_00330862 predicted 346
10 SASI_Mm02_00330863 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224238 predicted 832
2 SASI_Mm01_00224239 predicted 293
3 SASI_Mm01_00224240 predicted 289
4 SASI_Mm01_00224241 predicted 702
5 SASI_Mm01_00224242 predicted 232
6 SASI_Mm01_00224243 predicted 739
7 SASI_Mm01_00224244 predicted 521
8 SASI_Mm01_00224245 predicted 614
9 SASI_Mm01_00224246 predicted 759
10 SASI_Mm01_00224247 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138455
VALIDATED
CTHRC1 MISSION shRNA Bacterial Glycerol Stock
collagen triple helix repeat containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-564s1c1
Sequence:CCGGGCGTTGGTATTTCACATTCAACTCGAGTTGAATGTGAAATACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-802s1c1
Sequence:CCGGCGCATCATTATTGAAGAACTACTCGAGTAGTTCTTCAATAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-346s1c1
Sequence:CCGGCGGGATGGATTCAAAGGAGAACTCGAGTTCTCCTTTGAATCCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138455.2-246s1c1
Sequence:CCGGCCTGTATAATGGAATGTGCTTCTCGAGAAGCACATTCCATTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-701s1c1
Sequence:CCGGGTGAAGGAATTGGTGCTGGATCTCGAGATCCAGCACCAATTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-872s21c1
Sequence:CCGGCTTGGAATGGTTCACTTAAATCTCGAGATTTAAGTGAACCATTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138455.2-606s21c1
Sequence:CCGGTCTTCCCATTGAAGCTATAATCTCGAGATTATAGCTTCAATGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-1064s21c1
Sequence:CCGGCATTCTCTCAACCTATAATTTCTCGAGAAATTATAGGTTGAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138455
VALIDATED
CTHRC1 MISSION shRNA shRNA Plasmid DNA
collagen triple helix repeat containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-564s1c1
Sequence:CCGGGCGTTGGTATTTCACATTCAACTCGAGTTGAATGTGAAATACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-802s1c1
Sequence:CCGGCGCATCATTATTGAAGAACTACTCGAGTAGTTCTTCAATAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-346s1c1
Sequence:CCGGCGGGATGGATTCAAAGGAGAACTCGAGTTCTCCTTTGAATCCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138455.2-246s1c1
Sequence:CCGGCCTGTATAATGGAATGTGCTTCTCGAGAAGCACATTCCATTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-701s1c1
Sequence:CCGGGTGAAGGAATTGGTGCTGGATCTCGAGATCCAGCACCAATTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-872s21c1
Sequence:CCGGCTTGGAATGGTTCACTTAAATCTCGAGATTTAAGTGAACCATTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138455.2-606s21c1
Sequence:CCGGTCTTCCCATTGAAGCTATAATCTCGAGATTATAGCTTCAATGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-1064s21c1
Sequence:CCGGCATTCTCTCAACCTATAATTTCTCGAGAAATTATAGGTTGAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138455
VALIDATED
CTHRC1 MISSION shRNA Lentiviral Transduction Particles
collagen triple helix repeat containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-564s1c1
Sequence:CCGGGCGTTGGTATTTCACATTCAACTCGAGTTGAATGTGAAATACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-802s1c1
Sequence:CCGGCGCATCATTATTGAAGAACTACTCGAGTAGTTCTTCAATAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-346s1c1
Sequence:CCGGCGGGATGGATTCAAAGGAGAACTCGAGTTCTCCTTTGAATCCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138455.2-246s1c1
Sequence:CCGGCCTGTATAATGGAATGTGCTTCTCGAGAAGCACATTCCATTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138455.2-701s1c1
Sequence:CCGGGTGAAGGAATTGGTGCTGGATCTCGAGATCCAGCACCAATTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-872s21c1
Sequence:CCGGCTTGGAATGGTTCACTTAAATCTCGAGATTTAAGTGAACCATTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138455.2-606s21c1
Sequence:CCGGTCTTCCCATTGAAGCTATAATCTCGAGATTATAGCTTCAATGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138455.2-1064s21c1
Sequence:CCGGCATTCTCTCAACCTATAATTTCTCGAGAAATTATAGGTTGAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128002
CTHRC1 MISSION shRNA Bacterial Glycerol Stock
collagen triple helix repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128002.4-857s1c1
Sequence:CCGGGCCCTTGAATGGTTCATTTAACTCGAGTTAAATGAACCATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-623s1c1
Sequence:CCGGGCCCTGAGTTAAATTCAACTACTCGAGTAGTTGAATTTAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-788s1c1
Sequence:CCGGTCATTGAAGAACTACCGAAATCTCGAGATTTCGGTAGTTCTTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-141s1c1
Sequence:CCGGGCTACAGTTGTCCGCACCGATCTCGAGATCGGTGCGGACAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-568s1c1
Sequence:CCGGGCTGAATGTTCAGGACCTCTTCTCGAGAAGAGGTCCTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128002
CTHRC1 MISSION shRNA shRNA Plasmid DNA
collagen triple helix repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128002.4-857s1c1
Sequence:CCGGGCCCTTGAATGGTTCATTTAACTCGAGTTAAATGAACCATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-623s1c1
Sequence:CCGGGCCCTGAGTTAAATTCAACTACTCGAGTAGTTGAATTTAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-788s1c1
Sequence:CCGGTCATTGAAGAACTACCGAAATCTCGAGATTTCGGTAGTTCTTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-141s1c1
Sequence:CCGGGCTACAGTTGTCCGCACCGATCTCGAGATCGGTGCGGACAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-568s1c1
Sequence:CCGGGCTGAATGTTCAGGACCTCTTCTCGAGAAGAGGTCCTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128002
CTHRC1 MISSION shRNA Lentiviral Transduction Particles
collagen triple helix repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128002.4-857s1c1
Sequence:CCGGGCCCTTGAATGGTTCATTTAACTCGAGTTAAATGAACCATTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-623s1c1
Sequence:CCGGGCCCTGAGTTAAATTCAACTACTCGAGTAGTTGAATTTAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-788s1c1
Sequence:CCGGTCATTGAAGAACTACCGAAATCTCGAGATTTCGGTAGTTCTTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-141s1c1
Sequence:CCGGGCTACAGTTGTCCGCACCGATCTCGAGATCGGTGCGGACAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128002.4-568s1c1
Sequence:CCGGGCTGAATGTTCAGGACCTCTTCTCGAGAAGAGGTCCTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks