EMAIL THIS PAGE TO A FRIEND

CTIF

CBP80/20-dependent translation initiation factor

71 Gene Product Result for
Synonyms: Gm672 KIAA0427
UniProtKB ID: O43310, B3KTR8, Q8IVD5
Gene ID:
Human(9811) Summary: CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]
Mouse(269037) CBP80/20-dependent translation initiation factor
Rat(364900) CBP80/20-dependent translation initiation factor
Zebrafish(100537309) CBP80/20-dependent translation initiation factor
cow(615119) CBP80/20-dependent translation initiation factor
Horse(100053562) CBP80/20-dependent translation initiation factor
domestic cat(101087878) CBP80/20-dependent translation initiation factor
dog(490571) CBP80/20-dependent translation initiation factor
chicken(770140) CBP80/20-dependent translation initiation factor
naked mole-rat(101716758) CBP80/20-dependent translation initiation factor
domestic guinea pig(100726220) CBP80/20-dependent translation initiation factor
sheep(101114917) CBP80/20-dependent translation initiation factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014772 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154441 MISSION® esiRNA esiRNA human KIAA0427 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014772 Rosetta Predictions human pricing
NM_001108891 Rosetta Predictions rat pricing
NM_201354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122149 predicted 585
2 SASI_Hs01_00122150 predicted 1586
3 SASI_Hs01_00122151 predicted 559
4 SASI_Hs01_00122152 predicted 1568
5 SASI_Hs01_00122153 predicted 1586
6 SASI_Hs01_00122154 predicted 1525
7 SASI_Hs01_00122155 predicted 1512
8 SASI_Hs01_00122156 predicted 527
9 SASI_Hs01_00122157 predicted 718
10 SASI_Hs01_00122158 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243105 predicted 650
2 SASI_Rn02_00243106 predicted 722
3 SASI_Rn02_00243107 predicted 854
4 SASI_Rn02_00243108 predicted 508
5 SASI_Rn02_00243109 predicted 1115
6 SASI_Rn02_00243110 predicted 1029
7 SASI_Rn02_00243111 predicted 932
8 SASI_Rn02_00243112 predicted 1170
9 SASI_Rn02_00243113 predicted 390
10 SASI_Rn02_00243114 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085731 predicted 632
2 SASI_Mm01_00085732 predicted 792
3 SASI_Mm01_00085733 predicted 1704
4 SASI_Mm01_00085734 predicted 856
5 SASI_Mm01_00085735 predicted 618
6 SASI_Mm01_00085736 predicted 1306
7 SASI_Mm01_00085737 predicted 1503
8 SASI_Mm01_00085738 predicted 631
9 SASI_Mm01_00085739 predicted 865
10 SASI_Mm01_00085740 predicted 1972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201354
CTIF MISSION shRNA Bacterial Glycerol Stock
CBP80/20-dependent translation initiation factor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-795s21c1
Sequence:CCGGGTATCAGCCTGAATGACATTGCTCGAGCAATGTCATTCAGGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1538s21c1
Sequence:CCGGATCCTTAACAGCATGAGAAATCTCGAGATTTCTCATGCTGTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1290s21c1
Sequence:CCGGAGGCTGAGATAAAGCATAAAGCTCGAGCTTTATGCTTTATCTCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-2022s1c1
Sequence:CCGGGCAGTACTACAACAGGACCATCTCGAGATGGTCCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-492s1c1
Sequence:CCGGCGCCAATACCTTTGATTCCTTCTCGAGAAGGAATCAAAGGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201354.1-3169s1c1
Sequence:CCGGGCTGGCAAATTACAACCAAATCTCGAGATTTGGTTGTAATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-1832s1c1
Sequence:CCGGGCTGTTCTATGGAGCTACAAACTCGAGTTTGTAGCTCCATAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201354
CTIF MISSION shRNA shRNA Plasmid DNA
CBP80/20-dependent translation initiation factor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-795s21c1
Sequence:CCGGGTATCAGCCTGAATGACATTGCTCGAGCAATGTCATTCAGGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1538s21c1
Sequence:CCGGATCCTTAACAGCATGAGAAATCTCGAGATTTCTCATGCTGTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1290s21c1
Sequence:CCGGAGGCTGAGATAAAGCATAAAGCTCGAGCTTTATGCTTTATCTCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-2022s1c1
Sequence:CCGGGCAGTACTACAACAGGACCATCTCGAGATGGTCCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-492s1c1
Sequence:CCGGCGCCAATACCTTTGATTCCTTCTCGAGAAGGAATCAAAGGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201354.1-3169s1c1
Sequence:CCGGGCTGGCAAATTACAACCAAATCTCGAGATTTGGTTGTAATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-1832s1c1
Sequence:CCGGGCTGTTCTATGGAGCTACAAACTCGAGTTTGTAGCTCCATAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201354
CTIF MISSION shRNA Lentiviral Transduction Particles
CBP80/20-dependent translation initiation factor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-795s21c1
Sequence:CCGGGTATCAGCCTGAATGACATTGCTCGAGCAATGTCATTCAGGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1538s21c1
Sequence:CCGGATCCTTAACAGCATGAGAAATCTCGAGATTTCTCATGCTGTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201354.2-1290s21c1
Sequence:CCGGAGGCTGAGATAAAGCATAAAGCTCGAGCTTTATGCTTTATCTCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-2022s1c1
Sequence:CCGGGCAGTACTACAACAGGACCATCTCGAGATGGTCCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-492s1c1
Sequence:CCGGCGCCAATACCTTTGATTCCTTCTCGAGAAGGAATCAAAGGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201354.1-3169s1c1
Sequence:CCGGGCTGGCAAATTACAACCAAATCTCGAGATTTGGTTGTAATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201354.1-1832s1c1
Sequence:CCGGGCTGTTCTATGGAGCTACAAACTCGAGTTTGTAGCTCCATAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014772
VALIDATED
CTIF MISSION shRNA Bacterial Glycerol Stock
CBP80/20-dependent translation initiation factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-3529s1c1
Sequence:CCGGGCCGCTTCCTTATTTGCTCTTCTCGAGAAGAGCAAATAAGGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014772.1-1590s1c1
Sequence:CCGGCGACAAGATGGCGCTCTTTATCTCGAGATAAAGAGCGCCATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014772.1-590s1c1
Sequence:CCGGCCAACACCTTCGATTCCTTCACTCGAGTGAAGGAATCGAAGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-2043s1c1
Sequence:CCGGGCAGTACTACAACAGAACCATCTCGAGATGGTTCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-1819s1c1
Sequence:CCGGCAATCTCAGGATGTGAAGGAACTCGAGTTCCTTCACATCCTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1392s1c1
Sequence:CCGGGAACAAGATGGACAAGCTGATCTCGAGATCAGCTTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-546s1c1
Sequence:CCGGCAAAGACAACTCTCTGGACATCTCGAGATGTCCAGAGAGTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_014772.1-1404s1c1
Sequence:CCGGCAAGCTGATCGAGATCCTGAACTCGAGTTCAGGATCTCGATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1831s1c1
Sequence:CCGGGTGAAGGAAGATGCTGTCCTTCTCGAGAAGGACAGCATCTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014772
VALIDATED
CTIF MISSION shRNA shRNA Plasmid DNA
CBP80/20-dependent translation initiation factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-3529s1c1
Sequence:CCGGGCCGCTTCCTTATTTGCTCTTCTCGAGAAGAGCAAATAAGGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014772.1-1590s1c1
Sequence:CCGGCGACAAGATGGCGCTCTTTATCTCGAGATAAAGAGCGCCATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014772.1-590s1c1
Sequence:CCGGCCAACACCTTCGATTCCTTCACTCGAGTGAAGGAATCGAAGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-2043s1c1
Sequence:CCGGGCAGTACTACAACAGAACCATCTCGAGATGGTTCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-1819s1c1
Sequence:CCGGCAATCTCAGGATGTGAAGGAACTCGAGTTCCTTCACATCCTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1392s1c1
Sequence:CCGGGAACAAGATGGACAAGCTGATCTCGAGATCAGCTTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-546s1c1
Sequence:CCGGCAAAGACAACTCTCTGGACATCTCGAGATGTCCAGAGAGTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_014772.1-1404s1c1
Sequence:CCGGCAAGCTGATCGAGATCCTGAACTCGAGTTCAGGATCTCGATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1831s1c1
Sequence:CCGGGTGAAGGAAGATGCTGTCCTTCTCGAGAAGGACAGCATCTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014772
VALIDATED
CTIF MISSION shRNA Lentiviral Transduction Particles
CBP80/20-dependent translation initiation factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-3529s1c1
Sequence:CCGGGCCGCTTCCTTATTTGCTCTTCTCGAGAAGAGCAAATAAGGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014772.1-1590s1c1
Sequence:CCGGCGACAAGATGGCGCTCTTTATCTCGAGATAAAGAGCGCCATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014772.1-590s1c1
Sequence:CCGGCCAACACCTTCGATTCCTTCACTCGAGTGAAGGAATCGAAGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014772.1-2043s1c1
Sequence:CCGGGCAGTACTACAACAGAACCATCTCGAGATGGTTCTGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-1819s1c1
Sequence:CCGGCAATCTCAGGATGTGAAGGAACTCGAGTTCCTTCACATCCTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1392s1c1
Sequence:CCGGGAACAAGATGGACAAGCTGATCTCGAGATCAGCTTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014772.1-546s1c1
Sequence:CCGGCAAAGACAACTCTCTGGACATCTCGAGATGTCCAGAGAGTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_014772.1-1404s1c1
Sequence:CCGGCAAGCTGATCGAGATCCTGAACTCGAGTTCAGGATCTCGATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014772.1-1831s1c1
Sequence:CCGGGTGAAGGAAGATGCTGTCCTTCTCGAGAAGGACAGCATCTTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks