EMAIL THIS PAGE TO A FRIEND

CTLA4

cytotoxic T-lymphocyte-associated protein 4

143 Gene Product Result for
Synonyms: CD CD152 CELIAC3 CTLA-4 GRD4 GSE IDDM12
Gene ID:
Human(1493) Summary: This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]
Mouse(12477) cytotoxic T-lymphocyte-associated protein 4
Rat(63835) cytotoxic T-lymphocyte-associated protein 4
Domestic Rabbit(100009412) cytotoxic T-lymphocyte-associated protein 4
domestic guinea pig(100725760) cytotoxic T-lymphocyte-associated protein 4
naked mole-rat(101722788) cytotoxic T-lymphocyte-associated protein 4
chicken(424106) cytotoxic T-lymphocyte-associated protein 4
domestic cat(493743) cytotoxic T-lymphocyte-associated protein 4
cow(281732) cytotoxic T-lymphocyte-associated protein 4
dog(403696) cytotoxic T-lymphocyte-associated protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124981 MISSION® esiRNA esiRNA human CTLA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037631 Rosetta Predictions human pricing
NM_005214 Rosetta Predictions human pricing
NM_031674 Rosetta Predictions rat pricing
NM_009843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237077 predicted 943
2 SASI_Hs01_00237078 predicted 308
3 SASI_Hs01_00237079 predicted 384
4 SASI_Hs02_00308333 predicted 934
5 SASI_Hs01_00237080 predicted 904
6 SASI_Hs01_00237081 predicted 328
7 SASI_Hs01_00237083 predicted 941
8 SASI_Hs01_00237084 predicted 944
9 SASI_Hs02_00308334 predicted 866
10 SASI_Hs01_00237085 predicted 855
11 SASI_Hs01_00237076 predicted 924
12 SASI_Hs01_00237082 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088365 predicted 1054
2 SASI_Hs01_00088366 predicted 310
3 SASI_Hs01_00088367 predicted 381
4 SASI_Hs02_00339191 predicted 1051
5 SASI_Hs01_00088368 predicted 1019
6 SASI_Hs01_00088369 predicted 332
7 SASI_Hs01_00088371 predicted 1054
8 SASI_Hs01_00088372 predicted 1055
9 SASI_Hs02_00339192 predicted 974
10 SASI_Hs01_00088373 predicted 967
11 SASI_Hs01_00088364 predicted 1030
12 SASI_Hs01_00088370 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265016 predicted 359
2 SASI_Rn01_00062410 predicted 325
3 SASI_Rn02_00265017 predicted 266
4 SASI_Rn01_00062411 predicted 435
5 SASI_Rn01_00062412 predicted 392
6 SASI_Rn01_00062413 predicted 484
7 SASI_Rn01_00062415 predicted 303
8 SASI_Rn01_00062416 predicted 450
9 SASI_Rn01_00062417 predicted 402
10 SASI_Rn01_00062419 predicted 449
11 SASI_Rn01_00062414 predicted 474
12 SASI_Rn01_00062418 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134320 predicted 861
2 SASI_Mm01_00134321 predicted 504
3 SASI_Mm01_00134322 predicted 541
4 SASI_Mm01_00134323 predicted 579
5 SASI_Mm01_00134324 predicted 695
6 SASI_Mm01_00134325 predicted 1101
7 SASI_Mm01_00134326 predicted 487
8 SASI_Mm01_00134327 predicted 414
9 SASI_Mm01_00134329 predicted 926
10 SASI_Mm02_00317213 predicted 618
11 SASI_Mm01_00134328 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005214
CTLA4 MISSION shRNA Bacterial Glycerol Stock
cytotoxic T-lymphocyte-associated protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005214.3-821s21c1
Sequence:CCGGATCAATTGAGAAACCATTATGCTCGAGCATAATGGTTTCTCAATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005214.3-1190s21c1
Sequence:CCGGTTTACGTATGAGACGTTTATACTCGAGTATAAACGTCTCATACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-315s1c1
Sequence:CCGGGCCAGCTTTGTGTGTGAGTATCTCGAGATACTCACACACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-590s1c1
Sequence:CCGGCGGAACCCAGATTTATGTAATCTCGAGATTACATAAATCTGGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-698s1c1
Sequence:CCGGCACAGCTGTTTCTTTGAGCAACTCGAGTTGCTCAAAGAAACAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-486s1c1
Sequence:CCGGCAAGTGAACCTCACTATCCAACTCGAGTTGGATAGTGAGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-564s1c1
Sequence:CCGGCCGCCATACTACCTGGGCATACTCGAGTATGCCCAGGTAGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005214
CTLA4 MISSION shRNA shRNA Plasmid DNA
cytotoxic T-lymphocyte-associated protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005214.3-821s21c1
Sequence:CCGGATCAATTGAGAAACCATTATGCTCGAGCATAATGGTTTCTCAATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005214.3-1190s21c1
Sequence:CCGGTTTACGTATGAGACGTTTATACTCGAGTATAAACGTCTCATACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-315s1c1
Sequence:CCGGGCCAGCTTTGTGTGTGAGTATCTCGAGATACTCACACACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-590s1c1
Sequence:CCGGCGGAACCCAGATTTATGTAATCTCGAGATTACATAAATCTGGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-698s1c1
Sequence:CCGGCACAGCTGTTTCTTTGAGCAACTCGAGTTGCTCAAAGAAACAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-486s1c1
Sequence:CCGGCAAGTGAACCTCACTATCCAACTCGAGTTGGATAGTGAGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-564s1c1
Sequence:CCGGCCGCCATACTACCTGGGCATACTCGAGTATGCCCAGGTAGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005214
CTLA4 MISSION shRNA Lentiviral Transduction Particles
cytotoxic T-lymphocyte-associated protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005214.3-821s21c1
Sequence:CCGGATCAATTGAGAAACCATTATGCTCGAGCATAATGGTTTCTCAATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005214.3-1190s21c1
Sequence:CCGGTTTACGTATGAGACGTTTATACTCGAGTATAAACGTCTCATACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-315s1c1
Sequence:CCGGGCCAGCTTTGTGTGTGAGTATCTCGAGATACTCACACACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-590s1c1
Sequence:CCGGCGGAACCCAGATTTATGTAATCTCGAGATTACATAAATCTGGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-698s1c1
Sequence:CCGGCACAGCTGTTTCTTTGAGCAACTCGAGTTGCTCAAAGAAACAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-486s1c1
Sequence:CCGGCAAGTGAACCTCACTATCCAACTCGAGTTGGATAGTGAGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005214.2-564s1c1
Sequence:CCGGCCGCCATACTACCTGGGCATACTCGAGTATGCCCAGGTAGTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009843
CTLA4 MISSION shRNA Bacterial Glycerol Stock
cytotoxic T-lymphocyte-associated protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-306s1c1
Sequence:CCGGGCCAGCTTTCCATGTGAATATCTCGAGATATTCACATGGAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-368s1c1
Sequence:CCGGGCGGCAGACAAATGACCAAATCTCGAGATTTGGTCATTTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-581s1c1
Sequence:CCGGCGGGACGCAGATTTATGTCATCTCGAGATGACATAAATCTGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-240s1c1
Sequence:CCGGCCAGTCTTCTCTGAAGCCATACTCGAGTATGGCTTCAGAGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-404s1c1
Sequence:CCGGCACGACATTCACAGAGAAGAACTCGAGTTCTTCTCTGTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009843
CTLA4 MISSION shRNA shRNA Plasmid DNA
cytotoxic T-lymphocyte-associated protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-306s1c1
Sequence:CCGGGCCAGCTTTCCATGTGAATATCTCGAGATATTCACATGGAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-368s1c1
Sequence:CCGGGCGGCAGACAAATGACCAAATCTCGAGATTTGGTCATTTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-581s1c1
Sequence:CCGGCGGGACGCAGATTTATGTCATCTCGAGATGACATAAATCTGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-240s1c1
Sequence:CCGGCCAGTCTTCTCTGAAGCCATACTCGAGTATGGCTTCAGAGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-404s1c1
Sequence:CCGGCACGACATTCACAGAGAAGAACTCGAGTTCTTCTCTGTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009843
CTLA4 MISSION shRNA Lentiviral Transduction Particles
cytotoxic T-lymphocyte-associated protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-306s1c1
Sequence:CCGGGCCAGCTTTCCATGTGAATATCTCGAGATATTCACATGGAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-368s1c1
Sequence:CCGGGCGGCAGACAAATGACCAAATCTCGAGATTTGGTCATTTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-581s1c1
Sequence:CCGGCGGGACGCAGATTTATGTCATCTCGAGATGACATAAATCTGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-240s1c1
Sequence:CCGGCCAGTCTTCTCTGAAGCCATACTCGAGTATGGCTTCAGAGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009843.2-404s1c1
Sequence:CCGGCACGACATTCACAGAGAAGAACTCGAGTTCTTCTCTGTGAATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks