EMAIL THIS PAGE TO A FRIEND

CTNNA1

catenin (cadherin-associated protein), alpha 1, 102kDa

129 Gene Product Result for
Synonyms: CAP102
UniProtKB ID: P35221, Q12795
Gene ID:
Mouse(12385) catenin (cadherin associated protein), alpha 1
Rat(307505) catenin (cadherin-associated protein), alpha 1, 102kDa
Zebrafish(100538100) catenin (cadherin-associated protein), alpha 1, 102kDa
Zebrafish(30741) catenin (cadherin-associated protein), alpha 1
cow(526848) catenin (cadherin-associated protein), alpha 1, 102kDa
Horse(100072548) catenin (cadherin-associated protein), alpha 1, 102kDa
domestic cat(101089324) catenin (cadherin-associated protein), alpha 1, 102kDa
dog(474698) catenin (cadherin-associated protein), alpha 1, 102kDa
chicken(416184) catenin (cadherin-associated protein), alpha 1, 102kDa
naked mole-rat(101715878) catenin (cadherin-associated protein), alpha 1, 102kDa
domestic guinea pig(100720469) catenin (cadherin-associated protein), alpha 1, 102kDa
sheep(101112313) catenin (cadherin-associated protein), alpha 1, 102kDa
Domestic Rabbit(100328952) catenin (cadherin-associated protein), alpha 1, 102kDa
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22832 Anti-α-1-Catenin (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
GW22836 Anti-α-1-Catenin (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human
western blot pricing
C2081 Anti-α-Catenin antibody produced in rabbit whole antiserum several mammalian species
dot blot, immunofluorescence, immunohistochemistry, microarray, western blot pricing
B6184 Anti-α-Catenin−Biotin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution several mammalian species
immunofluorescence pricing
C8114 Anti-α-E-Catenin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution canine, human, rat
immunocytochemistry, microarray, western blot pricing
SAB2500201 Anti-Catenin α1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500539 Anti-Catenin-α1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4500540 Anti-Catenin-α1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1306700 ANTI-CTNA1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB2701701 Anti-ctnna antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701705 Anti-ctnna antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701741 Anti-ctnna antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB4300567 Anti-CTNNA1 (Ab-641) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
HPA046119 Anti-CTNNA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA063535 Anti-CTNNA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4300628 Anti-phospho-CK2α (pThr360/Ser362) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300258 Anti-phospho-CTNNA1 (pSer641) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB1402163 Monoclonal Anti-CTNNA1 antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001903 Rosetta Predictions human pricing
NM_001007145 Rosetta Predictions rat pricing
NM_009818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217322 predicted 606
2 SASI_Hs01_00217323 predicted 511
3 SASI_Hs01_00217324 predicted 2281
4 SASI_Hs01_00217325 predicted 209
5 SASI_Hs01_00217326 predicted 1922
6 SASI_Hs01_00217327 predicted 1429
7 SASI_Hs01_00217328 predicted 2274
8 SASI_Hs01_00217329 predicted 2361
9 SASI_Hs02_00332778 predicted 486
10 SASI_Hs01_00217331 predicted 225
11 SASI_Hs01_00217330 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105307 predicted 1152
2 SASI_Rn01_00105310 predicted 1368
3 SASI_Rn01_00105311 predicted 680
4 SASI_Rn01_00105312 predicted 771
5 SASI_Rn01_00105313 predicted 1114
6 SASI_Rn02_00198619 predicted 617
7 SASI_Rn01_00105314 predicted 596
8 SASI_Rn02_00198620 predicted 539
9 SASI_Rn01_00105315 predicted 2845
10 SASI_Rn01_00105316 predicted 967
11 SASI_Rn01_00105308 predicted 1889
12 SASI_Rn01_00105309 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166116 predicted 758
2 SASI_Mm01_00166117 predicted 1639
3 SASI_Mm01_00166118 predicted 626
4 SASI_Mm01_00166120 predicted 200
5 SASI_Mm01_00166121 predicted 772
6 SASI_Mm01_00166122 predicted 561
7 SASI_Mm02_00317119 predicted 1415
8 SASI_Mm02_00317120 predicted 2008
9 SASI_Mm01_00166123 predicted 1263
10 SASI_Mm02_00317121 predicted 677
11 SASI_Mm01_00166114 predicted 1158
12 SASI_Mm01_00166115 predicted 498
13 SASI_Mm01_00166119 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001903
VALIDATED
CTNNA1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 1, 102kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-3074s1c1
Sequence:CCGGCCACATTAGCTTGTTAGTAATCTCGAGATTACTAACAAGCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-936s1c1
Sequence:CCGGGCACTCAATAACTTTGACAAACTCGAGTTTGTCAAAGTTATTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-594s1c1
Sequence:CCGGGCTGGCAATGAACAAGACTTACTCGAGTAAGTCTTGTTCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-209s1c1
Sequence:CCGGCCTTGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-609s21c1
Sequence:CCGGGACTTAGGAATCCAGTATAAACTCGAGTTTATACTGGATTCCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-1471s21c1
Sequence:CCGGCCCTCTGTCCTCAGGTTATTACTCGAGTAATAACCTGAGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001903.2-3440s21c1
Sequence:CCGGCAGTGTCTCGATGCCATAATCCTCGAGGATTATGGCATCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-789s21c1
Sequence:CCGGCCTGATGTCGCAGCCTATAAGCTCGAGCTTATAGGCTGCGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-224s21c1
Sequence:CCGGTAGTAAAGGGCCCTCTAATAACTCGAGTTATTAGAGGGCCCTTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001903
VALIDATED
CTNNA1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 1, 102kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-3074s1c1
Sequence:CCGGCCACATTAGCTTGTTAGTAATCTCGAGATTACTAACAAGCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-936s1c1
Sequence:CCGGGCACTCAATAACTTTGACAAACTCGAGTTTGTCAAAGTTATTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-594s1c1
Sequence:CCGGGCTGGCAATGAACAAGACTTACTCGAGTAAGTCTTGTTCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-209s1c1
Sequence:CCGGCCTTGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-609s21c1
Sequence:CCGGGACTTAGGAATCCAGTATAAACTCGAGTTTATACTGGATTCCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-1471s21c1
Sequence:CCGGCCCTCTGTCCTCAGGTTATTACTCGAGTAATAACCTGAGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001903.2-3440s21c1
Sequence:CCGGCAGTGTCTCGATGCCATAATCCTCGAGGATTATGGCATCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-789s21c1
Sequence:CCGGCCTGATGTCGCAGCCTATAAGCTCGAGCTTATAGGCTGCGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-224s21c1
Sequence:CCGGTAGTAAAGGGCCCTCTAATAACTCGAGTTATTAGAGGGCCCTTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001903
VALIDATED
CTNNA1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 1, 102kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-3074s1c1
Sequence:CCGGCCACATTAGCTTGTTAGTAATCTCGAGATTACTAACAAGCTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-936s1c1
Sequence:CCGGGCACTCAATAACTTTGACAAACTCGAGTTTGTCAAAGTTATTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001903.2-594s1c1
Sequence:CCGGGCTGGCAATGAACAAGACTTACTCGAGTAAGTCTTGTTCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001903.2-209s1c1
Sequence:CCGGCCTTGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-609s21c1
Sequence:CCGGGACTTAGGAATCCAGTATAAACTCGAGTTTATACTGGATTCCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-1471s21c1
Sequence:CCGGCCCTCTGTCCTCAGGTTATTACTCGAGTAATAACCTGAGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001903.2-3440s21c1
Sequence:CCGGCAGTGTCTCGATGCCATAATCCTCGAGGATTATGGCATCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-789s21c1
Sequence:CCGGCCTGATGTCGCAGCCTATAAGCTCGAGCTTATAGGCTGCGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001903.2-224s21c1
Sequence:CCGGTAGTAAAGGGCCCTCTAATAACTCGAGTTATTAGAGGGCCCTTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009818
VALIDATED
CTNNA1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 1, 102kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1351s1c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1764s1c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-186s1c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009818.1-912s1c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1764s21c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1351s21c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-186s21c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-912s21c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009818
VALIDATED
CTNNA1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 1, 102kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1351s1c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1764s1c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-186s1c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009818.1-912s1c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1764s21c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1351s21c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-186s21c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-912s21c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009818
VALIDATED
CTNNA1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 1, 102kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1351s1c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-1764s1c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009818.1-186s1c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009818.1-912s1c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1764s21c1
Sequence:CCGGGCCAGGAGTTTACACAGAGAACTCGAGTTCTCTGTGTAAACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-1351s21c1
Sequence:CCGGGCCAACAAACTGATTGAGGTTCTCGAGAACCTCAATCAGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-186s21c1
Sequence:CCGGCCTGGTAAACACCAATAGTAACTCGAGTTACTATTGGTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009818.1-912s21c1
Sequence:CCGGCGCTCTCAACAACTTTGATAACTCGAGTTATCAAAGTTGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks