EMAIL THIS PAGE TO A FRIEND

CTNNA2

catenin (cadherin-associated protein), alpha 2

Synonyms: CAP-R CAPR CT114 CTNR
Gene ID:
Mouse(12386) catenin (cadherin associated protein), alpha 2
Rat(297357) catenin (cadherin associated protein), alpha 2
Zebrafish(567500) catenin (cadherin-associated protein), alpha 2
chicken(396035) catenin (cadherin-associated protein), alpha 2
dog(483088) catenin (cadherin-associated protein), alpha 2
cow(527492) catenin (cadherin-associated protein), alpha 2
Horse(100053393) catenin (cadherin-associated protein), alpha 2
sheep(101121501) catenin (cadherin-associated protein), alpha 2
domestic guinea pig(100730912) catenin (cadherin-associated protein), alpha 2
naked mole-rat(101714477) catenin (cadherin-associated protein), alpha 2
Gene Class: Cytoskeleton
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059331 MISSION® esiRNA esiRNA human CTNNA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004389 Rosetta Predictions human pricing
NM_001106598 Rosetta Predictions rat pricing
NM_001109764 Rosetta Predictions mouse pricing
NM_009819 Rosetta Predictions mouse pricing
NM_145732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024054 predicted 2658
2 SASI_Hs01_00024055 predicted 2014
3 SASI_Hs01_00024056 predicted 2003
4 SASI_Hs01_00024057 predicted 2556
5 SASI_Hs01_00024058 predicted 2326
6 SASI_Hs01_00024059 predicted 334
7 SASI_Hs01_00024060 predicted 2514
8 SASI_Hs01_00024061 predicted 315
9 SASI_Hs01_00024062 predicted 1050
10 SASI_Hs01_00024063 predicted 2543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220528 predicted 383
2 SASI_Rn02_00220529 predicted 2905
3 SASI_Rn02_00220530 predicted 2569
4 SASI_Rn02_00220531 predicted 1245
5 SASI_Rn02_00220532 predicted 2066
6 SASI_Rn02_00220533 predicted 2430
7 SASI_Rn02_00220534 predicted 2639
8 SASI_Rn02_00220535 predicted 2919
9 SASI_Rn02_00220536 predicted 559
10 SASI_Rn02_00220537 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304344 predicted 1649
2 SASI_Mm02_00304345 predicted 550
3 SASI_Mm02_00304346 predicted 2056
4 SASI_Mm02_00304347 predicted 651
5 SASI_Mm02_00304348 predicted 2158
6 SASI_Mm02_00304349 predicted 876
7 SASI_Mm02_00304350 predicted 1946
8 SASI_Mm02_00304351 predicted 578
9 SASI_Mm02_00304352 predicted 1595
10 SASI_Mm02_00304353 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317122 predicted 1550
2 SASI_Mm01_00026246 predicted 450
3 SASI_Mm01_00026248 predicted 1947
4 SASI_Mm02_00317123 predicted 552
5 SASI_Mm01_00026249 predicted 2052
6 SASI_Mm01_00026250 predicted 770
7 SASI_Mm02_00317124 predicted 1841
8 SASI_Mm01_00026251 predicted 467
9 SASI_Mm01_00026252 predicted 1494
10 SASI_Mm01_00026254 predicted 782
11 SASI_Mm01_00026245 predicted 1217
12 SASI_Mm01_00026247 predicted 2348
13 SASI_Mm01_00026253 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341266 predicted 1654
2 SASI_Mm02_00341267 predicted 3077
3 SASI_Mm01_00086211 predicted 545
4 SASI_Mm01_00086212 predicted 3065
5 SASI_Mm01_00086215 predicted 2057
6 SASI_Mm02_00341268 predicted 653
7 SASI_Mm01_00086216 predicted 2155
8 SASI_Mm02_00341269 predicted 872
9 SASI_Mm01_00086217 predicted 3052
10 SASI_Mm02_00341270 predicted 1940
11 SASI_Mm01_00086209 predicted 2946
12 SASI_Mm01_00086210 predicted 1320
13 SASI_Mm01_00086213 predicted 2978
14 SASI_Mm01_00086214 predicted 2448
15 SASI_Mm01_00086218 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004389
CTNNA2 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-615s21c1
Sequence:CCGGTGACCCTTGCTCGTCGGTAAACTCGAGTTTACCGACGAGCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3436s21c1
Sequence:CCGGTGTACTAGCCAATACGCTTAACTCGAGTTAAGCGTATTGGCTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3136s21c1
Sequence:CCGGTAAGATGAGATGAGATCAATACTCGAGTATTGATCTCATCTCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-940s21c1
Sequence:CCGGTACACGGCCTCTCAAGCATTTCTCGAGAAATGCTTGAGAGGCCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3256s21c1
Sequence:CCGGGTTCGCATTGGCGCAATATTTCTCGAGAAATATTGCGCCAATGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1210s1c1
Sequence:CCGGGAAACCAATGTTCCTTTGCTACTCGAGTAGCAAAGGAACATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-744s1c1
Sequence:CCGGCAACCGAGATTATGTGTTCAACTCGAGTTGAACACATAATCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-2494s1c1
Sequence:CCGGGAGGTAGATTGTGATGTCATACTCGAGTATGACATCACAATCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1927s1c1
Sequence:CCGGCCAGAAGAACTAGAGGATGATCTCGAGATCATCCTCTAGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-526s1c1
Sequence:CCGGGCTACAAATGAGCAAGACCTTCTCGAGAAGGTCTTGCTCATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004389
CTNNA2 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-615s21c1
Sequence:CCGGTGACCCTTGCTCGTCGGTAAACTCGAGTTTACCGACGAGCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3436s21c1
Sequence:CCGGTGTACTAGCCAATACGCTTAACTCGAGTTAAGCGTATTGGCTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3136s21c1
Sequence:CCGGTAAGATGAGATGAGATCAATACTCGAGTATTGATCTCATCTCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-940s21c1
Sequence:CCGGTACACGGCCTCTCAAGCATTTCTCGAGAAATGCTTGAGAGGCCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3256s21c1
Sequence:CCGGGTTCGCATTGGCGCAATATTTCTCGAGAAATATTGCGCCAATGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1210s1c1
Sequence:CCGGGAAACCAATGTTCCTTTGCTACTCGAGTAGCAAAGGAACATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-744s1c1
Sequence:CCGGCAACCGAGATTATGTGTTCAACTCGAGTTGAACACATAATCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-2494s1c1
Sequence:CCGGGAGGTAGATTGTGATGTCATACTCGAGTATGACATCACAATCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1927s1c1
Sequence:CCGGCCAGAAGAACTAGAGGATGATCTCGAGATCATCCTCTAGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-526s1c1
Sequence:CCGGGCTACAAATGAGCAAGACCTTCTCGAGAAGGTCTTGCTCATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004389
CTNNA2 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-615s21c1
Sequence:CCGGTGACCCTTGCTCGTCGGTAAACTCGAGTTTACCGACGAGCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3436s21c1
Sequence:CCGGTGTACTAGCCAATACGCTTAACTCGAGTTAAGCGTATTGGCTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3136s21c1
Sequence:CCGGTAAGATGAGATGAGATCAATACTCGAGTATTGATCTCATCTCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004389.3-940s21c1
Sequence:CCGGTACACGGCCTCTCAAGCATTTCTCGAGAAATGCTTGAGAGGCCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004389.3-3256s21c1
Sequence:CCGGGTTCGCATTGGCGCAATATTTCTCGAGAAATATTGCGCCAATGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1210s1c1
Sequence:CCGGGAAACCAATGTTCCTTTGCTACTCGAGTAGCAAAGGAACATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-744s1c1
Sequence:CCGGCAACCGAGATTATGTGTTCAACTCGAGTTGAACACATAATCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-2494s1c1
Sequence:CCGGGAGGTAGATTGTGATGTCATACTCGAGTATGACATCACAATCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-1927s1c1
Sequence:CCGGCCAGAAGAACTAGAGGATGATCTCGAGATCATCCTCTAGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004389.1-526s1c1
Sequence:CCGGGCTACAAATGAGCAAGACCTTCTCGAGAAGGTCTTGCTCATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145732
CTNNA2 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145732.1-3561s1c1
Sequence:CCGGCCCGTCTCAAATGTTTCTTTACTCGAGTAAAGAAACATTTGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1117s1c1
Sequence:CCGGGCCCTGAATGAGTTTGATAATCTCGAGATTATCAAACTCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1927s1c1
Sequence:CCGGCGGGTCATTCACATCATCAATCTCGAGATTGATGATGTGAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-2783s1c1
Sequence:CCGGCGTCTTATGTAGCCTCAACTACTCGAGTAGTTGAGGCTACATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1926s1c1
Sequence:CCGGCCGGGTCATTCACATCATCAACTCGAGTTGATGATGTGAATGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145732
CTNNA2 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145732.1-3561s1c1
Sequence:CCGGCCCGTCTCAAATGTTTCTTTACTCGAGTAAAGAAACATTTGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1117s1c1
Sequence:CCGGGCCCTGAATGAGTTTGATAATCTCGAGATTATCAAACTCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1927s1c1
Sequence:CCGGCGGGTCATTCACATCATCAATCTCGAGATTGATGATGTGAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-2783s1c1
Sequence:CCGGCGTCTTATGTAGCCTCAACTACTCGAGTAGTTGAGGCTACATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1926s1c1
Sequence:CCGGCCGGGTCATTCACATCATCAACTCGAGTTGATGATGTGAATGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145732
CTNNA2 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145732.1-3561s1c1
Sequence:CCGGCCCGTCTCAAATGTTTCTTTACTCGAGTAAAGAAACATTTGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1117s1c1
Sequence:CCGGGCCCTGAATGAGTTTGATAATCTCGAGATTATCAAACTCATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1927s1c1
Sequence:CCGGCGGGTCATTCACATCATCAATCTCGAGATTGATGATGTGAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-2783s1c1
Sequence:CCGGCGTCTTATGTAGCCTCAACTACTCGAGTAGTTGAGGCTACATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145732.1-1926s1c1
Sequence:CCGGCCGGGTCATTCACATCATCAACTCGAGTTGATGATGTGAATGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks