EMAIL THIS PAGE TO A FRIEND

CTNNA3

catenin (cadherin-associated protein), alpha 3

103 Gene Product Result for
Synonyms: VR22
UniProtKB ID: Q9UI47, Q5VSR2, Q6P056
Gene ID:
Mouse(216033) catenin (cadherin associated protein), alpha 3
Rat(361839) catenin (cadherin associated protein), alpha 3
naked mole-rat(101724879) catenin (cadherin-associated protein), alpha 3
domestic guinea pig(100729463) catenin (cadherin-associated protein), alpha 3
sheep(101123346) catenin (cadherin-associated protein), alpha 3
Domestic Rabbit(100343241) catenin (cadherin-associated protein), alpha 3
chicken(423648) catenin (cadherin-associated protein), alpha 3
dog(489008) catenin (cadherin-associated protein), alpha 3
Horse(100062915) catenin (cadherin-associated protein), alpha 3
domestic cat(101086346) catenin (cadherin-associated protein), alpha 3
cow(780777) catenin (cadherin-associated protein), alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013266 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061051 MISSION® esiRNA esiRNA human CTNNA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127384 Rosetta Predictions human pricing
NM_013266 Rosetta Predictions human pricing
XM_342133 Rosetta Predictions rat pricing
NM_177612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329324 predicted 2179
2 SASI_Hs02_00329325 predicted 1083
3 SASI_Hs02_00329326 predicted 1195
4 SASI_Hs02_00329327 predicted 1406
5 SASI_Hs02_00329328 predicted 2603
6 SASI_Hs02_00329329 predicted 1973
7 SASI_Hs02_00329330 predicted 1958
8 SASI_Hs02_00329331 predicted 1275
9 SASI_Hs02_00329332 predicted 1819
10 SASI_Hs02_00329333 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014233 predicted 2258
2 SASI_Hs01_00014234 predicted 1159
3 SASI_Hs02_00344492 predicted 1267
4 SASI_Hs01_00014235 predicted 1474
5 SASI_Hs01_00014236 predicted 2681
6 SASI_Hs01_00014237 predicted 2048
7 SASI_Hs01_00014238 predicted 2031
8 SASI_Hs01_00014242 predicted 1346
9 SASI_Hs02_00344493 predicted 1893
10 SASI_Hs02_00344494 predicted 1876
11 SASI_Hs01_00014239 predicted 260
12 SASI_Hs01_00014240 predicted 1480
13 SASI_Hs01_00014241 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393794 predicted 634
2 SASI_Rn02_00393795 predicted 519
3 SASI_Rn02_00393796 predicted 733
4 SASI_Rn02_00393797 predicted 218
5 SASI_Rn02_00393798 predicted 322
6 SASI_Rn02_00393799 predicted 312
7 SASI_Rn02_00393800 predicted 313
8 SASI_Rn02_00393801 predicted 230
9 SASI_Rn02_00393802 predicted 220
10 SASI_Rn02_00393803 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347841 predicted 208
2 SASI_Mm01_00158573 predicted 1646
3 SASI_Mm01_00158574 predicted 967
4 SASI_Mm01_00158575 predicted 1589
5 SASI_Mm01_00158576 predicted 1939
6 SASI_Mm01_00158577 predicted 1923
7 SASI_Mm01_00158578 predicted 1062
8 SASI_Mm01_00158579 predicted 2630
9 SASI_Mm01_00158580 predicted 2242
10 SASI_Mm01_00158581 predicted 393
11 SASI_Mm01_00158582 predicted 2483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177612
CTNNA3 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1886s1c1
Sequence:CCGGGCGCTTGATGATAATCAGTTTCTCGAGAAACTGATTATCATCAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1382s1c1
Sequence:CCGGGCTTGTTCCATGTCAACGAATCTCGAGATTCGTTGACATGGAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-980s1c1
Sequence:CCGGCCATCACTAGAGAAACGCCTACTCGAGTAGGCGTTTCTCTAGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-479s1c1
Sequence:CCGGGCAGTTACAAGACTCCTTGTTCTCGAGAACAAGGAGTCTTGTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-2646s1c1
Sequence:CCGGCGGCTAAGAAGCCCTTGATTACTCGAGTAATCAAGGGCTTCTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177612
CTNNA3 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1886s1c1
Sequence:CCGGGCGCTTGATGATAATCAGTTTCTCGAGAAACTGATTATCATCAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1382s1c1
Sequence:CCGGGCTTGTTCCATGTCAACGAATCTCGAGATTCGTTGACATGGAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-980s1c1
Sequence:CCGGCCATCACTAGAGAAACGCCTACTCGAGTAGGCGTTTCTCTAGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-479s1c1
Sequence:CCGGGCAGTTACAAGACTCCTTGTTCTCGAGAACAAGGAGTCTTGTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-2646s1c1
Sequence:CCGGCGGCTAAGAAGCCCTTGATTACTCGAGTAATCAAGGGCTTCTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177612
CTNNA3 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1886s1c1
Sequence:CCGGGCGCTTGATGATAATCAGTTTCTCGAGAAACTGATTATCATCAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-1382s1c1
Sequence:CCGGGCTTGTTCCATGTCAACGAATCTCGAGATTCGTTGACATGGAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-980s1c1
Sequence:CCGGCCATCACTAGAGAAACGCCTACTCGAGTAGGCGTTTCTCTAGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-479s1c1
Sequence:CCGGGCAGTTACAAGACTCCTTGTTCTCGAGAACAAGGAGTCTTGTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177612.1-2646s1c1
Sequence:CCGGCGGCTAAGAAGCCCTTGATTACTCGAGTAATCAAGGGCTTCTTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013266
CTNNA3 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-1828s1c1
Sequence:CCGGCACGGGTGAAATGGACAGTTACTCGAGTAACTGTCCATTTCACCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2345s1c1
Sequence:CCGGCCACTAAAGCATACAACTGATCTCGAGATCAGTTGTATGCTTTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2243s1c1
Sequence:CCGGGAGATTGAGATATGGGATGATCTCGAGATCATCCCATATCTCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1201s1c1
Sequence:CCGGGCTTTCAGAGTACATGAACAACTCGAGTTGTTCATGTACTCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2354s1c1
Sequence:CCGGCATACAACTGATGTGATCTATCTCGAGATAGATCACATCAGTTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1307s1c1
Sequence:CCGGCGCAAGGCTATTATAGATCATCTCGAGATGATCTATAATAGCCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2479s1c1
Sequence:CCGGCCTGGAACAGATTAAGTTCTACTCGAGTAGAACTTAATCTGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-767s1c1
Sequence:CCGGCCAAATCAGAGAGATGAAATTCTCGAGAATTTCATCTCTCTGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1249s1c1
Sequence:CCGGCCTGAATATTGCTTTAGACAACTCGAGTTGTCTAAAGCAATATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013266
CTNNA3 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-1828s1c1
Sequence:CCGGCACGGGTGAAATGGACAGTTACTCGAGTAACTGTCCATTTCACCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2345s1c1
Sequence:CCGGCCACTAAAGCATACAACTGATCTCGAGATCAGTTGTATGCTTTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2243s1c1
Sequence:CCGGGAGATTGAGATATGGGATGATCTCGAGATCATCCCATATCTCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1201s1c1
Sequence:CCGGGCTTTCAGAGTACATGAACAACTCGAGTTGTTCATGTACTCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2354s1c1
Sequence:CCGGCATACAACTGATGTGATCTATCTCGAGATAGATCACATCAGTTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1307s1c1
Sequence:CCGGCGCAAGGCTATTATAGATCATCTCGAGATGATCTATAATAGCCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2479s1c1
Sequence:CCGGCCTGGAACAGATTAAGTTCTACTCGAGTAGAACTTAATCTGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-767s1c1
Sequence:CCGGCCAAATCAGAGAGATGAAATTCTCGAGAATTTCATCTCTCTGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1249s1c1
Sequence:CCGGCCTGAATATTGCTTTAGACAACTCGAGTTGTCTAAAGCAATATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013266
CTNNA3 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-1828s1c1
Sequence:CCGGCACGGGTGAAATGGACAGTTACTCGAGTAACTGTCCATTTCACCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2345s1c1
Sequence:CCGGCCACTAAAGCATACAACTGATCTCGAGATCAGTTGTATGCTTTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2243s1c1
Sequence:CCGGGAGATTGAGATATGGGATGATCTCGAGATCATCCCATATCTCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1201s1c1
Sequence:CCGGGCTTTCAGAGTACATGAACAACTCGAGTTGTTCATGTACTCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-2354s1c1
Sequence:CCGGCATACAACTGATGTGATCTATCTCGAGATAGATCACATCAGTTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1307s1c1
Sequence:CCGGCGCAAGGCTATTATAGATCATCTCGAGATGATCTATAATAGCCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-2479s1c1
Sequence:CCGGCCTGGAACAGATTAAGTTCTACTCGAGTAGAACTTAATCTGTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013266.1-767s1c1
Sequence:CCGGCCAAATCAGAGAGATGAAATTCTCGAGAATTTCATCTCTCTGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013266.1-1249s1c1
Sequence:CCGGCCTGAATATTGCTTTAGACAACTCGAGTTGTCTAAAGCAATATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)