EMAIL THIS PAGE TO A FRIEND

CTNNAL1

catenin (cadherin-associated protein), alpha-like 1

55 Gene Product Result for
Synonyms: CLLP alpha-CATU
Gene ID:
Mouse(54366) catenin (cadherin associated protein), alpha-like 1
Rat(298019) catenin (cadherin associated protein), alpha-like 1
Zebrafish(100034581) catenin (cadherin-associated protein), alpha-like 1
domestic cat(101089405) catenin (cadherin-associated protein), alpha-like 1
dog(610662) catenin (cadherin-associated protein), alpha-like 1
cow(515749) catenin (cadherin-associated protein), alpha-like 1
Horse(100059165) catenin (cadherin-associated protein), alpha-like 1
chicken(100858912) catenin (cadherin-associated protein), alpha-like 1
sheep(101101872) catenin (cadherin-associated protein), alpha-like 1
Domestic Rabbit(100349969) catenin (cadherin-associated protein), alpha-like 1
domestic guinea pig(100712798) catenin (cadherin-associated protein), alpha-like 1
naked mole-rat(101722186) catenin (cadherin-associated protein), alpha-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003798 Rosetta Predictions human pricing
NM_001106649 Rosetta Predictions rat pricing
NM_018761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108303 predicted 1744
2 SASI_Hs01_00108304 predicted 605
3 SASI_Hs01_00108305 predicted 1499
4 SASI_Hs01_00108307 predicted 1635
5 SASI_Hs01_00108309 predicted 419
6 SASI_Hs01_00108310 predicted 1372
7 SASI_Hs02_00336319 predicted 276
8 SASI_Hs01_00108311 predicted 1024
9 SASI_Hs01_00108312 predicted 239
10 SASI_Hs02_00336320 predicted 1839
11 SASI_Hs01_00108306 predicted 1738
12 SASI_Hs01_00108308 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221028 predicted 2281
2 SASI_Rn02_00221029 predicted 239
3 SASI_Rn02_00221030 predicted 574
4 SASI_Rn02_00221031 predicted 1760
5 SASI_Rn02_00221032 predicted 252
6 SASI_Rn02_00221033 predicted 649
7 SASI_Rn02_00221034 predicted 1287
8 SASI_Rn02_00221035 predicted 300
9 SASI_Rn02_00221036 predicted 675
10 SASI_Rn02_00221037 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023287 predicted 1245
2 SASI_Mm02_00324069 predicted 2123
3 SASI_Mm01_00023288 predicted 2092
4 SASI_Mm01_00023289 predicted 2101
5 SASI_Mm01_00023290 predicted 777
6 SASI_Mm01_00023292 predicted 245
7 SASI_Mm01_00023293 predicted 206
8 SASI_Mm01_00023294 predicted 214
9 SASI_Mm01_00023295 predicted 2320
10 SASI_Mm01_00023296 predicted 2328
11 SASI_Mm01_00023291 predicted 1988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003798
VALIDATED
CTNNAL1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003798.1-2279s1c1
Sequence:CCGGCATGTGATGAAGCTGACATTTCTCGAGAAATGTCAGCTTCATCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-2135s1c1
Sequence:CCGGGCTCTCTTAGTCCAACTTCTTCTCGAGAAGAAGTTGGACTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-350s1c1
Sequence:CCGGGCTTGTATTGAAGCTAAACAACTCGAGTTGTTTAGCTTCAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003798.1-2056s1c1
Sequence:CCGGGACAGTAACTAAGACTTCTTTCTCGAGAAAGAAGTCTTAGTTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-1427s1c1
Sequence:CCGGCCTCTGGAAATAACCTGTATACTCGAGTATACAGGTTATTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-180s21c1
Sequence:CCGGTCAGATCACCACGCTTATTAACTCGAGTTAATAAGCGTGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-515s21c1
Sequence:CCGGTGGCAGACCGAGTAGTCATTACTCGAGTAATGACTACTCGGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1507s21c1
Sequence:CCGGACATTGCATCCATCTAGTAAACTCGAGTTTACTAGATGGATGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1394s21c1
Sequence:CCGGGTCGATTGTTACGACACATATCTCGAGATATGTGTCGTAACAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1250s21c1
Sequence:CCGGAGCTGGCAGCAGATCTATTAACTCGAGTTAATAGATCTGCTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003798
VALIDATED
CTNNAL1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003798.1-2279s1c1
Sequence:CCGGCATGTGATGAAGCTGACATTTCTCGAGAAATGTCAGCTTCATCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-2135s1c1
Sequence:CCGGGCTCTCTTAGTCCAACTTCTTCTCGAGAAGAAGTTGGACTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-350s1c1
Sequence:CCGGGCTTGTATTGAAGCTAAACAACTCGAGTTGTTTAGCTTCAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003798.1-2056s1c1
Sequence:CCGGGACAGTAACTAAGACTTCTTTCTCGAGAAAGAAGTCTTAGTTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-1427s1c1
Sequence:CCGGCCTCTGGAAATAACCTGTATACTCGAGTATACAGGTTATTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-180s21c1
Sequence:CCGGTCAGATCACCACGCTTATTAACTCGAGTTAATAAGCGTGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-515s21c1
Sequence:CCGGTGGCAGACCGAGTAGTCATTACTCGAGTAATGACTACTCGGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1507s21c1
Sequence:CCGGACATTGCATCCATCTAGTAAACTCGAGTTTACTAGATGGATGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1394s21c1
Sequence:CCGGGTCGATTGTTACGACACATATCTCGAGATATGTGTCGTAACAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1250s21c1
Sequence:CCGGAGCTGGCAGCAGATCTATTAACTCGAGTTAATAGATCTGCTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003798
VALIDATED
CTNNAL1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003798.1-2279s1c1
Sequence:CCGGCATGTGATGAAGCTGACATTTCTCGAGAAATGTCAGCTTCATCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-2135s1c1
Sequence:CCGGGCTCTCTTAGTCCAACTTCTTCTCGAGAAGAAGTTGGACTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-350s1c1
Sequence:CCGGGCTTGTATTGAAGCTAAACAACTCGAGTTGTTTAGCTTCAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003798.1-2056s1c1
Sequence:CCGGGACAGTAACTAAGACTTCTTTCTCGAGAAAGAAGTCTTAGTTACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003798.1-1427s1c1
Sequence:CCGGCCTCTGGAAATAACCTGTATACTCGAGTATACAGGTTATTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-180s21c1
Sequence:CCGGTCAGATCACCACGCTTATTAACTCGAGTTAATAAGCGTGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-515s21c1
Sequence:CCGGTGGCAGACCGAGTAGTCATTACTCGAGTAATGACTACTCGGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1507s21c1
Sequence:CCGGACATTGCATCCATCTAGTAAACTCGAGTTTACTAGATGGATGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1394s21c1
Sequence:CCGGGTCGATTGTTACGACACATATCTCGAGATATGTGTCGTAACAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003798.2-1250s21c1
Sequence:CCGGAGCTGGCAGCAGATCTATTAACTCGAGTTAATAGATCTGCTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018761
VALIDATED
CTNNAL1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), alpha-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2586s1c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-1694s1c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-438s1c1
Sequence:CCGGCGGAGCCATTTGGAATCAGATCTCGAGATCTGATTCCAAATGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-552s1c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2105s1c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-2128s21c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-1717s21c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018761.3-2609s21c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-575s21c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018761
VALIDATED
CTNNAL1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), alpha-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2586s1c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-1694s1c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-438s1c1
Sequence:CCGGCGGAGCCATTTGGAATCAGATCTCGAGATCTGATTCCAAATGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-552s1c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2105s1c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-2128s21c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-1717s21c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018761.3-2609s21c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-575s21c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018761
VALIDATED
CTNNAL1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), alpha-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2586s1c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-1694s1c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-438s1c1
Sequence:CCGGCGGAGCCATTTGGAATCAGATCTCGAGATCTGATTCCAAATGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-552s1c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018761.2-2105s1c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-2128s21c1
Sequence:CCGGGCAGAGTAAAGTCTTTCTAAACTCGAGTTTAGAAAGACTTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-1717s21c1
Sequence:CCGGGCCCACGAAGAATAGTGCAAACTCGAGTTTGCACTATTCTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018761.3-2609s21c1
Sequence:CCGGGCGGATTATTTACAACACTAACTCGAGTTAGTGTTGTAAATAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018761.3-575s21c1
Sequence:CCGGCGTGTAGTCATCAAGCAGATACTCGAGTATCTGCTTGATGACTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks