EMAIL THIS PAGE TO A FRIEND

CTNNB1

catenin (cadherin-associated protein), beta 1, 88kDa

166 Gene Product Result for
Synonyms: CTNNB MRD19 armadillo
UniProtKB ID: P35222, A8K1L7, Q8NEW9, Q8NI94, Q9H391
Gene ID:
Human(1499) Summary: The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Three transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(12387) catenin (cadherin associated protein), beta 1
Rat(84353) catenin (cadherin associated protein), beta 1
naked mole-rat(101720578) catenin (cadherin-associated protein), beta 1, 88kDa
domestic guinea pig(100732604) catenin (cadherin-associated protein), beta 1, 88kDa
sheep(100294600) catenin (cadherin-associated protein), beta 1, 88kDa
Domestic Rabbit(100125985) catenin (cadherin-associated protein), beta 1, 88kDa
Zebrafish(30265) catenin (cadherin-associated protein), beta 1
chicken(395964) catenin (cadherin-associated protein), beta 1, 88kDa
cow(539003) catenin (cadherin-associated protein), beta 1, 88kDa
Horse(100055241) catenin (cadherin-associated protein), beta 1, 88kDa
domestic cat(101097342) catenin (cadherin-associated protein), beta 1, 88kDa
dog(477032) catenin (cadherin-associated protein), beta 1, 88kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C2206 Anti-β-Catenin antibody produced in rabbit whole antiserum several mammalian species
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
C7738 Anti-β-Catenin−Cy3 antibody, Mouse monoclonal clone 15B8, purified from hybridoma cell culture bovine, canine, chicken, human
immunofluorescence pricing
SAB4500545 Anti-Catenin-β antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4500541 Anti-Catenin-β, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4500542 Anti-Catenin-β, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500543 Anti-Catenin-β, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500544 Anti-Catenin-β, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500546 Anti-Catenin-β1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1306576 ANTI-CTNB1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300470 Anti-CTNNB1 (Ab-33) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300471 Anti-CTNNB1 (Ab-37) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300381 Anti-CTNNB1 (Ab-41/45) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300586 Anti-CTNNB1 (Ab-654) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
AV14001 Anti-CTNNB1 (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, pig, bovine, zebrafish, chicken, mouse, rat, human
immunohistochemistry, western blot pricing
SAB2701829 Anti-ctnnb1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701804 Anti-ctnnb1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107856 Anti-CTNNB1 antibody produced in rabbit IgG fraction of antiserum canine, human, zebrafish, guinea pig, mouse, pig, rabbit, horse
western blot pricing
SAB2107867 Anti-CTNNB1 antibody produced in rabbit IgG fraction of antiserum canine, pig, horse, guinea pig, human, mouse, zebrafish, rabbit
western blot pricing
SAB2100502 Anti-CTNNB1 antibody produced in rabbit affinity isolated antibody canine, mouse, rat, zebrafish, bovine, pig, rabbit, human, guinea pig, horse
western blot pricing
HPA029159 Anti-CTNNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA029160 Anti-CTNNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry pricing
C4231 Anti-phospho-β-Catenin (pSer33/pSer37) antibody, Mouse monoclonal clone BC-22, purified from hybridoma cell culture chicken, rat, human, mouse
ELISA, microarray, western blot pricing
SAB4300630 Anti-phospho-β-catenin (pTyr333) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504347 Anti-phospho-Catenin-β (pSer33) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4504348 Anti-phospho-Catenin-β (pSer37) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504349 Anti-phospho-Catenin-β (pThr41/Ser45) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504573 Anti-phospho-Catenin-β (pTyr489) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301557 Anti-phospho-Catenin-β (pTyr489) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504128 Anti-phospho-Catenin-β (pTyr654) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4300175 Anti-phospho-CTNNB1 (pSer33) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300176 Anti-phospho-CTNNB1 (pSer37) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4300095 Anti-phospho-CTNNB1 (pThr41/pSer45) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
C7082 Monoclonal Anti-β-Catenin antibody produced in mouse clone 6F9, ascites fluid canine, human, chicken, bovine
immunofluorescence, microarray, western blot pricing
C7207 Monoclonal Anti-β-Catenin antibody produced in mouse clone 15B8, ascites fluid bovine, canine, chicken, human
immunofluorescence, immunohistochemistry, microarray, western blot pricing
WH0001499M2 Monoclonal Anti-CTNNB1 antibody produced in mouse clone 1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100534 Monoclonal Anti-CTNNB1 antibody produced in mouse clone CTNNB1-A482, culture supernatant human
western blot pricing
AMAB91209 Monoclonal Anti-CTNNB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3689, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91210 Monoclonal Anti-CTNNB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3691, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1403713 Monoclonal Anti-CTNNB1, (C-terminal) antibody produced in mouse clone 3A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
C2363 Monoclonal Anti-phospho-β-Catenin (pSer33) antibody produced in mouse clone BC-76, purified immunoglobulin, buffered aqueous solution human
microarray, western blot pricing
C5615 Monoclonal Anti-phospho-β-Catenin (pSer45) antibody produced in mouse clone BCS-45, purified immunoglobulin, buffered aqueous solution mouse, monkey, rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
C8616 Monoclonal Anti-phospho-β-Catenin (pThr41) antibody produced in mouse clone BCT-41, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
PLA0230 Rabbit anti-Beta-catenin Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, rat, bovine, dog, horse, toad, chicken, pig, human, zebrafish, toad, rabbit, guinea pig
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLL1149 A549 Cells GFP-CTNNB1 RFP-LMNB1 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-665 Anti-Active-β-Catenin (Anti-ABC) Antibody, clone 8E7 100 µg, Anti-Active-β-Catenin (anti-ABC) Antibody, clone 8E7 is a well characterized Mouse Monoclonal Antibody. This highly published mAb also known as Anti-Catenin beta-1 readily detects beta-Catenin & has been validated in FC, ICC, IHC, IHC(P) & WB. pricing
05-665-AF488 Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 488 100 µL, This Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 488 is validated for use in Immunocytochemistry, Flow Cytometry, Immunohistochemistry for the detection of Active-β-Catenin. pricing
05-665-AF555 Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 555 100 µL, This Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 555 is validated for use in Immunocytochemistry, Immunohistochemistry for the detection of Active-β-Catenin. pricing
05-665-AF647 Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 647 100 µL, This Anti-Active-β-Catenin Antibody, clone 8E7, Alexa Fluor® 647 is validated for use in Immunocytochemistry, Flow Cytometry for the detection of Active-β-Catenin. pricing
AB19022 Anti-beta-Catenin Antibody 50 µL, Use Anti-beta-Catenin Antibody (Rabbit Polyclonal Antibody) validated in ELISA, ICC, IHC, IHC(P), IP, WB to detect beta-Catenin also known as β-catenin. pricing
04-958 Anti-Beta Catenin Antibody, clone 7F7.2 100 µg, This Anti-Beta Catenin Antibody, clone 7F7.2 is validated for use in WB, IC for the detection of Beta Catenin. pricing
06-734 Anti-β-Catenin Antibody 200 µg, Use Anti-β-Catenin Antibody (Rabbit Polyclonal Antibody) validated in ICC, IP, WB to detect β-Catenin also known as catenin (cadherin-associated protein) beta 1 (88kD). pricing
ABE208 Anti-β-Catenin Antibody 100 µg, Anti-β-Catenin Antibody is a Rabbit Polyclonal Antibody for detection of β-Catenin also known as catenin (cadherin-associated protein) beta 1 (88kD) & has been validated in WB, ICC & IP. pricing
05-613 Anti-β-Catenin Antibody, clone 2H4A7 200 µg, Detect β-Catenin also known as beta catenin with Anti-β-Catenin Antibody, clone 2H4A7 (Mouse Monoclonal Antibody), that has been demonstrated to work in IP, WB & IHC. pricing
MAB2081 Anti-β-Catenin Antibody, clone 5H10 100 µg, Anti-β-Catenin Antibody, clone 5H10 is a Mouse Monoclonal Antibody for detection of β-Catenin also known as beta catenin & has been tested in ICC, IHC, IHC(P), IP & WB. pricing
MAB3790 Anti-β-Catenin Antibody, clone 9F12.2 200 µg, Detect β-Catenin also known as beta catenin with Anti-β-Catenin Antibody, clone 9F12.2 (Mouse Monoclonal Antibody), that has been demonstrated to work in WB. pricing
ABS484 Anti-phospho-Beta Catenin Antibody (Thr556) 100 µg, Anti-phospho-Beta Catenin Antibody (Thr556) is a highly specific rabbit polyclonal antibody, that targets Catenin & has been tested in western blotting & Peptide Inhibition Assay. pricing
ABS481 Anti-phospho Beta Catenin (Ser675) Antibody 200 µL, Anti-phospho Beta Catenin (Ser675) Antibody is a highly specific rabbit polyclonal antibody, that targets Catenin & has been tested in western blotting & Peptide Inhibition Assay. pricing
07-1651 Anti-phospho-β Catenin (Ser37) Antibody 100 µL, This Anti-phospho-β Catenin (Ser37) Antibody is validated for use in WB for the detection of phospho-β Catenin (Ser37). pricing
FCMAB120P Milli-Mark Anti-Beta-catenin-PE Antibody, clone 7F7.2 100 tests, This Milli-Mark Anti-Beta-catenin Antibody, clone 7F7.2 is validated for use in FC for the detection of Beta-catenin. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098209 Rosetta Predictions human pricing
NM_001098210 Rosetta Predictions human pricing
NM_001904 siRNAs that have been validated in the lab human pricing
NM_053357 Rosetta Predictions rat pricing
NM_007614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318698 predicted 780
2 SASI_Hs02_00318699 predicted 2206
3 SASI_Hs02_00318700 predicted 842
4 SASI_Hs02_00318701 predicted 620
5 SASI_Hs02_00318702 predicted 706
6 SASI_Hs02_00318703 predicted 2024
7 SASI_Hs02_00318704 predicted 1376
8 SASI_Hs02_00318705 predicted 1421
9 SASI_Hs02_00318706 predicted 1977
10 SASI_Hs02_00318707 predicted 2400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318708 predicted 775
2 SASI_Hs02_00318709 predicted 2205
3 SASI_Hs02_00318710 predicted 841
4 SASI_Hs02_00318711 predicted 621
5 SASI_Hs02_00318712 predicted 703
6 SASI_Hs02_00318713 predicted 2029
7 SASI_Hs02_00318714 predicted 1379
8 SASI_Hs02_00318715 predicted 1427
9 SASI_Hs02_00318716 predicted 1977
10 SASI_Hs02_00318717 predicted 2400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001904 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117960 validated 836
1 SASI_Hs01_00117958 validated 785
2 SASI_Hs01_00117959 predicted 2200
3 SASI_Hs01_00117961 predicted 617
4 SASI_Hs01_00117962 predicted 700
5 SASI_Hs01_00117963 predicted 2027
6 SASI_Hs01_00117964 predicted 1380
7 SASI_Hs02_00332779 predicted 1427
8 SASI_Hs01_00117965 predicted 1982
9 SASI_Hs01_00117966 predicted 2394
10 SASI_Hs01_00117967 predicted 2279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099923 predicted 353
2 SASI_Rn01_00099924 predicted 1281
3 SASI_Rn01_00099925 predicted 905
4 SASI_Rn01_00099926 predicted 1139
5 SASI_Rn01_00099927 predicted 1270
6 SASI_Rn01_00099928 predicted 905
7 SASI_Rn01_00099929 predicted 1765
8 SASI_Rn01_00099930 predicted 1439
9 SASI_Rn01_00099931 predicted 519
10 SASI_Rn01_00099932 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161710 predicted 1601
2 SASI_Mm01_00161711 predicted 1108
3 SASI_Mm01_00161712 predicted 1365
4 SASI_Mm01_00161714 predicted 599
5 SASI_Mm02_00312064 predicted 719
6 SASI_Mm01_00161715 predicted 632
7 SASI_Mm01_00161716 predicted 1904
8 SASI_Mm01_00161717 predicted 2337
9 SASI_Mm01_00161718 predicted 1998
10 SASI_Mm01_00161719 predicted 565
11 SASI_Mm01_00161713 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001904
VALIDATED
CTNNB1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), beta 1, 88kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001904.3-2708s21c1
Sequence:CCGGGGGAGTGGTTTAGGCTATTTGCTCGAGCAAATAGCCTAAACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2031s21c1
Sequence:CCGGTTGTTATCAGAGGACTAAATACTCGAGTATTTAGTCCTCTGATAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1309s21c1
Sequence:CCGGATCTGTCTGCTCTAGTAATAACTCGAGTTATTACTAGAGCAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2333s21c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1541s21c1
Sequence:CCGGTCTAACCTCACTTGCAATAATCTCGAGATTATTGCAAGTGAGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001904.x-1248s1c1
Sequence:CCGGAGGTGCTATCTGTCTGCTCTACTCGAGTAGAGCAGACAGATAGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-1907s1c1
Sequence:CCGGCGCATGGAAGAAATAGTTGAACTCGAGTTCAACTATTTCTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2279s1c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001904.x-2566s1c1
Sequence:CCGGCCTTTAGCTGTATTGTCTGAACTCGAGTTCAGACAATACAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2003s1c1
Sequence:CCGGCCATTGTTTGTGCAGCTGCTTCTCGAGAAGCAGCTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001904
VALIDATED
CTNNB1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), beta 1, 88kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001904.3-2708s21c1
Sequence:CCGGGGGAGTGGTTTAGGCTATTTGCTCGAGCAAATAGCCTAAACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2031s21c1
Sequence:CCGGTTGTTATCAGAGGACTAAATACTCGAGTATTTAGTCCTCTGATAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1309s21c1
Sequence:CCGGATCTGTCTGCTCTAGTAATAACTCGAGTTATTACTAGAGCAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2333s21c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1541s21c1
Sequence:CCGGTCTAACCTCACTTGCAATAATCTCGAGATTATTGCAAGTGAGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001904.x-1248s1c1
Sequence:CCGGAGGTGCTATCTGTCTGCTCTACTCGAGTAGAGCAGACAGATAGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-1907s1c1
Sequence:CCGGCGCATGGAAGAAATAGTTGAACTCGAGTTCAACTATTTCTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2279s1c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001904.x-2566s1c1
Sequence:CCGGCCTTTAGCTGTATTGTCTGAACTCGAGTTCAGACAATACAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2003s1c1
Sequence:CCGGCCATTGTTTGTGCAGCTGCTTCTCGAGAAGCAGCTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001904
VALIDATED
CTNNB1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), beta 1, 88kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001904.3-2708s21c1
Sequence:CCGGGGGAGTGGTTTAGGCTATTTGCTCGAGCAAATAGCCTAAACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2031s21c1
Sequence:CCGGTTGTTATCAGAGGACTAAATACTCGAGTATTTAGTCCTCTGATAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1309s21c1
Sequence:CCGGATCTGTCTGCTCTAGTAATAACTCGAGTTATTACTAGAGCAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-2333s21c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001904.3-1541s21c1
Sequence:CCGGTCTAACCTCACTTGCAATAATCTCGAGATTATTGCAAGTGAGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001904.x-1248s1c1
Sequence:CCGGAGGTGCTATCTGTCTGCTCTACTCGAGTAGAGCAGACAGATAGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-1907s1c1
Sequence:CCGGCGCATGGAAGAAATAGTTGAACTCGAGTTCAACTATTTCTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2279s1c1
Sequence:CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001904.x-2566s1c1
Sequence:CCGGCCTTTAGCTGTATTGTCTGAACTCGAGTTCAGACAATACAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001904.x-2003s1c1
Sequence:CCGGCCATTGTTTGTGCAGCTGCTTCTCGAGAAGCAGCTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007614
VALIDATED
CTNNB1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), beta 1, 88kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000012689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-2001s1c1
Sequence:CCGGCCATTGTTTGTGCAGTTGCTTCTCGAGAAGCAACTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007614.2-450s1c1
Sequence:CCGGGCTGATATTGACGGGCAGTATCTCGAGATACTGCCCGTCAATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-1174s1c1
Sequence:CCGGCCCAAGCCTTAGTAAACATAACTCGAGTTATGTTTACTAAGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-594s1c1
Sequence:CCGGCCATCACAGATGTTGAAACATCTCGAGATGTTTCAACATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007614
VALIDATED
CTNNB1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), beta 1, 88kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000012689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-2001s1c1
Sequence:CCGGCCATTGTTTGTGCAGTTGCTTCTCGAGAAGCAACTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007614.2-450s1c1
Sequence:CCGGGCTGATATTGACGGGCAGTATCTCGAGATACTGCCCGTCAATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-1174s1c1
Sequence:CCGGCCCAAGCCTTAGTAAACATAACTCGAGTTATGTTTACTAAGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-594s1c1
Sequence:CCGGCCATCACAGATGTTGAAACATCTCGAGATGTTTCAACATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007614
VALIDATED
CTNNB1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), beta 1, 88kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000012689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-2001s1c1
Sequence:CCGGCCATTGTTTGTGCAGTTGCTTCTCGAGAAGCAACTGCACAAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007614.2-450s1c1
Sequence:CCGGGCTGATATTGACGGGCAGTATCTCGAGATACTGCCCGTCAATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-1174s1c1
Sequence:CCGGCCCAAGCCTTAGTAAACATAACTCGAGTTATGTTTACTAAGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007614.2-594s1c1
Sequence:CCGGCCATCACAGATGTTGAAACATCTCGAGATGTTTCAACATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks