EMAIL THIS PAGE TO A FRIEND

CTNNBIP1

catenin, beta interacting protein 1

179 Gene Product Result for
Synonyms: ICAT
UniProtKB ID: Q9NSA3, Q5T4V2
Gene ID:
Human(56998) Summary: The protein encoded by this gene binds CTNNB1 and prevents interaction between CTNNB1 and TCF family members. The encoded protein is a negative regulator of the Wnt signaling pathway. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67087) catenin beta interacting protein 1
Rat(503000) catenin, beta-interacting protein 1
Zebrafish(58117) catenin, beta interacting protein 1
chicken(771460) catenin, beta interacting protein 1
dog(608589) catenin, beta interacting protein 1
cow(614630) catenin, beta interacting protein 1
domestic cat(101094518) catenin, beta interacting protein 1
sheep(101116924) catenin, beta interacting protein 1
domestic guinea pig(100720351) catenin, beta interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012329 Rosetta Predictions human pricing
NM_020248 Rosetta Predictions human pricing
XM_001075213 Rosetta Predictions rat pricing
XM_001078135 Rosetta Predictions rat pricing
XM_578512 Rosetta Predictions rat pricing
NM_023465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195523 predicted 992
2 SASI_Hs01_00195524 predicted 867
3 SASI_Hs01_00195525 predicted 705
4 SASI_Hs01_00195526 predicted 700
5 SASI_Hs01_00195527 predicted 940
6 SASI_Hs01_00195528 predicted 902
7 SASI_Hs01_00195529 predicted 691
8 SASI_Hs01_00195530 predicted 861
9 SASI_Hs01_00195532 predicted 933
10 SASI_Hs02_00306080 predicted 830
11 SASI_Hs01_00195531 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036816 predicted 1024
2 SASI_Hs01_00036817 predicted 895
3 SASI_Hs01_00036818 predicted 747
4 SASI_Hs01_00036819 predicted 728
5 SASI_Hs01_00036820 predicted 975
6 SASI_Hs01_00036821 predicted 939
7 SASI_Hs01_00036822 predicted 719
8 SASI_Hs01_00036823 predicted 895
9 SASI_Hs01_00036825 predicted 972
10 SASI_Hs02_00353203 predicted 866
11 SASI_Hs01_00036824 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348860 predicted 467
2 SASI_Rn02_00348861 predicted 354
3 SASI_Rn02_00348862 predicted 642
4 SASI_Rn02_00348863 predicted 848
5 SASI_Rn02_00348864 predicted 655
6 SASI_Rn02_00348865 predicted 815
7 SASI_Rn02_00348866 predicted 892
8 SASI_Rn02_00348867 predicted 512
9 SASI_Rn02_00348868 predicted 926
10 SASI_Rn02_00348869 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359771 predicted 443
2 SASI_Rn02_00359772 predicted 613
3 SASI_Rn02_00359773 predicted 830
4 SASI_Rn02_00359774 predicted 640
5 SASI_Rn02_00359775 predicted 796
6 SASI_Rn02_00359776 predicted 874
7 SASI_Rn02_00359777 predicted 490
8 SASI_Rn02_00359778 predicted 908
9 SASI_Rn02_00359779 predicted 964
10 SASI_Rn02_00359780 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139977 predicted 426
2 SASI_Rn01_00139978 predicted 288
3 SASI_Rn01_00139979 predicted 252
4 SASI_Rn01_00139980 predicted 419
5 SASI_Rn01_00139981 predicted 391
6 SASI_Rn01_00139982 predicted 387
7 SASI_Rn01_00139983 predicted 221
8 SASI_Rn01_00139984 predicted 390
9 SASI_Rn01_00139985 predicted 305
10 SASI_Rn01_00139986 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054131 predicted 949
2 SASI_Mm01_00054132 predicted 825
3 SASI_Mm01_00054133 predicted 645
4 SASI_Mm01_00054134 predicted 900
5 SASI_Mm01_00054135 predicted 648
6 SASI_Mm01_00054136 predicted 664
7 SASI_Mm01_00054137 predicted 859
8 SASI_Mm02_00327124 predicted 880
9 SASI_Mm02_00327125 predicted 631
10 SASI_Mm01_00054130 predicted 355
11 SASI_Mm01_00054128 predicted 524
12 SASI_Mm01_00054129 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020248
VALIDATED
CTNNBIP1 MISSION shRNA Bacterial Glycerol Stock
catenin, beta interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-348s1c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-385s1c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020248.1-438s1c1
Sequence:CCGGGCCTCCGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-301s1c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-419s21c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-335s21c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-382s21c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-725s21c1
Sequence:CCGGGACACCAGTGGTGCGTTTATACTCGAGTATAAACGCACCACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-551s21c1
Sequence:CCGGTAGCTGCAAAGCCCTTGGAACCTCGAGGTTCCAAGGGCTTTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020248
VALIDATED
CTNNBIP1 MISSION shRNA shRNA Plasmid DNA
catenin, beta interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-348s1c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-385s1c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020248.1-438s1c1
Sequence:CCGGGCCTCCGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-301s1c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-419s21c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-335s21c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-382s21c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-725s21c1
Sequence:CCGGGACACCAGTGGTGCGTTTATACTCGAGTATAAACGCACCACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-551s21c1
Sequence:CCGGTAGCTGCAAAGCCCTTGGAACCTCGAGGTTCCAAGGGCTTTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020248
VALIDATED
CTNNBIP1 MISSION shRNA Lentiviral Transduction Particles
catenin, beta interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-348s1c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-385s1c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020248.1-438s1c1
Sequence:CCGGGCCTCCGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020248.1-301s1c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-419s21c1
Sequence:CCGGGAGGAGTTCCTGCGCACCTATCTCGAGATAGGTGCGCAGGAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-335s21c1
Sequence:CCGGAGTCCGGAGGAGATGTACATTCTCGAGAATGTACATCTCCTCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-382s21c1
Sequence:CCGGGCTGCGGAAGATGGGATCAAACTCGAGTTTGATCCCATCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020248.2-725s21c1
Sequence:CCGGGACACCAGTGGTGCGTTTATACTCGAGTATAAACGCACCACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020248.2-551s21c1
Sequence:CCGGTAGCTGCAAAGCCCTTGGAACCTCGAGGTTCCAAGGGCTTTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023465
VALIDATED
CTNNBIP1 MISSION shRNA Bacterial Glycerol Stock
catenin, beta interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023465.2-2449s1c1
Sequence:CCGGCCCTGTGAGATTGTATCTAAACTCGAGTTTAGATACAATCTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-359s1c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023465.2-278s1c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-412s1c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-471s1c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-473s21c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-280s21c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-361s21c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-414s21c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023465
VALIDATED
CTNNBIP1 MISSION shRNA shRNA Plasmid DNA
catenin, beta interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023465.2-2449s1c1
Sequence:CCGGCCCTGTGAGATTGTATCTAAACTCGAGTTTAGATACAATCTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-359s1c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023465.2-278s1c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-412s1c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-471s1c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-473s21c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-280s21c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-361s21c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-414s21c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023465
VALIDATED
CTNNBIP1 MISSION shRNA Lentiviral Transduction Particles
catenin, beta interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023465.2-2449s1c1
Sequence:CCGGCCCTGTGAGATTGTATCTAAACTCGAGTTTAGATACAATCTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-359s1c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023465.2-278s1c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-412s1c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023465.2-471s1c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-473s21c1
Sequence:CCGGAGACGGAAGACCGGAGGCAGTCTCGAGACTGCCTCCGGTCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-280s21c1
Sequence:CCGGCCGGAGGAGATGTACATTCAACTCGAGTTGAATGTACATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-361s21c1
Sequence:CCGGGAGGAATTTCTGCGCACCTATCTCGAGATAGGTGCGCAGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023465.4-414s21c1
Sequence:CCGGGCCACAGCACTCCATCGACCACTCGAGTGGTCGATGGAGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks