EMAIL THIS PAGE TO A FRIEND

CTNNBL1

catenin, beta like 1

133 Gene Product Result for
Synonyms: C20orf33 NAP P14L PP8304 dJ633O20.1
Gene ID:
Human(56259) Summary: The protein encoded by this gene contains an acidic domain, a putative bipartite nuclear localization signal, a nuclear export signal, a leucine-isoleucine zipper, and phosphorylation motifs. In addition, the encoded protein contains Armadillo/beta-catenin-like repeats, which have been implicated in protein-protein interactions. Although the function of this protein has not been determined, the C-terminal portion of the protein has been shown to possess apoptosis-inducing activity. [provided by RefSeq, Jul 2008]
Mouse(66642) catenin, beta like 1
Rat(296320) catenin, beta like 1
domestic guinea pig(100712911) catenin, beta like 1
naked mole-rat(101701714) catenin, beta like 1
sheep(780469) catenin, beta like 1
Domestic Rabbit(100352656) catenin, beta like 1
Zebrafish(393840) catenin, beta like 1
cow(282421) catenin, beta like 1
Horse(100055457) catenin, beta like 1
domestic cat(101099706) catenin, beta like 1
dog(477224) catenin, beta like 1
chicken(419299) catenin, beta like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027907 Anti-CTNNBL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500994 Anti-CTTNBL1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0056259M1 Monoclonal Anti-CTNNBL1 antibody produced in mouse clone 5F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030877 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030877 Rosetta Predictions human pricing
NM_001024870 Rosetta Predictions rat pricing
NM_025680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027566 predicted 938
2 SASI_Hs01_00027567 predicted 889
3 SASI_Hs01_00027568 predicted 1185
4 SASI_Hs01_00027570 predicted 561
5 SASI_Hs01_00027571 predicted 1498
6 SASI_Hs01_00027572 predicted 1401
7 SASI_Hs01_00027573 predicted 1107
8 SASI_Hs02_00358411 predicted 575
9 SASI_Hs01_00027575 predicted 1046
10 SASI_Hs02_00358412 predicted 1432
11 SASI_Hs01_00027569 predicted 389
12 SASI_Hs01_00027574 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077890 predicted 899
2 SASI_Rn01_00077893 predicted 1173
3 SASI_Rn01_00077894 predicted 970
4 SASI_Rn01_00077895 predicted 360
5 SASI_Rn01_00077896 predicted 516
6 SASI_Rn01_00077897 predicted 1190
7 SASI_Rn02_00202748 predicted 987
8 SASI_Rn01_00077898 predicted 1392
9 SASI_Rn01_00077899 predicted 341
10 SASI_Rn02_00202749 predicted 1368
11 SASI_Rn01_00077891 predicted 282
12 SASI_Rn01_00077892 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031397 predicted 913
2 SASI_Mm01_00031398 predicted 1815
3 SASI_Mm01_00031400 predicted 1377
4 SASI_Mm01_00031401 predicted 532
5 SASI_Mm01_00031403 predicted 1188
6 SASI_Mm01_00031404 predicted 988
7 SASI_Mm01_00031405 predicted 1180
8 SASI_Mm01_00031406 predicted 312
9 SASI_Mm02_00328824 predicted 303
10 SASI_Mm02_00328825 predicted 324
11 SASI_Mm01_00031399 predicted 373
12 SASI_Mm01_00031402 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025680
VALIDATED
CTNNBL1 MISSION shRNA Bacterial Glycerol Stock
catenin, beta like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-366s21c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1655s21c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-721s21c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1547s21c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025680.2-2096s1c1
Sequence:CCGGCCTGTGCTTCTGTCTTCAAATCTCGAGATTTGAAGACAGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-722s1c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-1656s1c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-1548s1c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-367s1c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025680
VALIDATED
CTNNBL1 MISSION shRNA shRNA Plasmid DNA
catenin, beta like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-366s21c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1655s21c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-721s21c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1547s21c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025680.2-2096s1c1
Sequence:CCGGCCTGTGCTTCTGTCTTCAAATCTCGAGATTTGAAGACAGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-722s1c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-1656s1c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-1548s1c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-367s1c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025680
VALIDATED
CTNNBL1 MISSION shRNA Lentiviral Transduction Particles
catenin, beta like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-366s21c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1655s21c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-721s21c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025680.3-1547s21c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025680.2-2096s1c1
Sequence:CCGGCCTGTGCTTCTGTCTTCAAATCTCGAGATTTGAAGACAGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-722s1c1
Sequence:CCGGCCCTAGCTATTGTGGAGAATACTCGAGTATTCTCCACAATAGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025680.2-1656s1c1
Sequence:CCGGCAGGCACATCATCAAGGAGTACTCGAGTACTCCTTGATGATGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-1548s1c1
Sequence:CCGGACAGCACATCTGTTACATCATCTCGAGATGATGTAACAGATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025680.2-367s1c1
Sequence:CCGGCGGATCAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030877
VALIDATED
CTNNBL1 MISSION shRNA Bacterial Glycerol Stock
catenin, beta like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1044s21c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-389s21c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1496s21c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030877.3-890s21c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1407s21c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-890s1c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030877.3-1496s1c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1407s1c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-389s1c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1044s1c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030877
VALIDATED
CTNNBL1 MISSION shRNA shRNA Plasmid DNA
catenin, beta like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1044s21c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-389s21c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1496s21c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030877.3-890s21c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1407s21c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-890s1c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030877.3-1496s1c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1407s1c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-389s1c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1044s1c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030877
VALIDATED
CTNNBL1 MISSION shRNA Lentiviral Transduction Particles
catenin, beta like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1044s21c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-389s21c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1496s21c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030877.3-890s21c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030877.3-1407s21c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-890s1c1
Sequence:CCGGGCCATATTGCTCCAGGACAATCTCGAGATTGTCCTGGAGCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030877.3-1496s1c1
Sequence:CCGGCGAGGAGAGATCATCGACAATCTCGAGATTGTCGATGATCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1407s1c1
Sequence:CCGGACAGACTAATGGAGTTGCATTCTCGAGAATGCAACTCCATTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-389s1c1
Sequence:CCGGCGGATTAAGTTTCCAGACAATCTCGAGATTGTCTGGAAACTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030877.3-1044s1c1
Sequence:CCGGGCTCCTGTCTAATGCTTAGTTCTCGAGAACTAAGCATTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks