EMAIL THIS PAGE TO A FRIEND

CTNND1

catenin (cadherin-associated protein), delta 1

395 Gene Product Result for
Synonyms: CAS CTNND P120CAS P120CTN p120 p120(CAS) p120(CTN)
Gene ID:
Human(1500) Summary: This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
Mouse(12388) catenin (cadherin associated protein), delta 1
Rat(311163) catenin (cadherin associated protein), delta 1
Zebrafish(556726) catenin (cadherin-associated protein), delta 1
dog(483489) catenin (cadherin-associated protein), delta 1
Horse(100067065) catenin (cadherin-associated protein), delta 1
cow(515187) catenin (cadherin-associated protein), delta 1
domestic cat(101091972) catenin (cadherin-associated protein), delta 1
chicken(428852) catenin (cadherin-associated protein), delta 1
sheep(101122978) catenin (cadherin-associated protein), delta 1
Domestic Rabbit(100358667) catenin (cadherin-associated protein), delta 1
naked mole-rat(101717872) catenin (cadherin-associated protein), delta 1
domestic guinea pig(100734878) catenin (cadherin-associated protein), delta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500550 Anti-Catenin-δ1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA015955 Anti-CTNND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA015954 Anti-CTNND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410262 Anti-CTNND1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2105104 Anti-CTNND1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, rabbit, rat, horse
western blot pricing
SAB5500155 Anti-P120 (Catenin delta 1) antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP63, affinity isolated antibody human (tested)
immunohistochemistry pricing
P1870 Anti-p120ctn antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
SAB4504158 Anti-phospho-Catenin-δ1 (pTyr228) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
P2732 Monoclonal Anti-p120ctn (Catenin-related) antibody produced in mouse clone 6H11, tissue culture supernatant mouse, chicken, human, canine, rat, bovine
ELISA, immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093581 MISSION® esiRNA esiRNA human CTNND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085458 Rosetta Predictions human pricing
NM_001085459 Rosetta Predictions human pricing
NM_001085460 Rosetta Predictions human pricing
NM_001085461 Rosetta Predictions human pricing
NM_001085462 Rosetta Predictions human pricing
NM_001085463 Rosetta Predictions human pricing
NM_001085464 Rosetta Predictions human pricing
NM_001085465 Rosetta Predictions human pricing
NM_001085466 Rosetta Predictions human pricing
NM_001085467 Rosetta Predictions human pricing
NM_001085468 Rosetta Predictions human pricing
NM_001085469 Rosetta Predictions human pricing
NM_001331 Rosetta Predictions human pricing
NM_001107740 Rosetta Predictions rat pricing
NM_001085448 Rosetta Predictions mouse pricing
NM_001085449 Rosetta Predictions mouse pricing
NM_001085450 Rosetta Predictions mouse pricing
NM_001085453 Rosetta Predictions mouse pricing
NM_007615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317795 predicted 1436
2 SASI_Hs02_00317796 predicted 1439
3 SASI_Hs02_00317797 predicted 2205
4 SASI_Hs02_00317798 predicted 1741
5 SASI_Hs02_00317799 predicted 1571
6 SASI_Hs02_00317800 predicted 1521
7 SASI_Hs02_00317801 predicted 1968
8 SASI_Hs02_00317802 predicted 1802
9 SASI_Hs02_00317803 predicted 1201
10 SASI_Hs02_00317804 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317805 predicted 1430
2 SASI_Hs02_00317806 predicted 1436
3 SASI_Hs02_00317807 predicted 2200
4 SASI_Hs02_00317808 predicted 1738
5 SASI_Hs02_00317809 predicted 1575
6 SASI_Hs02_00317810 predicted 1524
7 SASI_Hs02_00317811 predicted 1968
8 SASI_Hs02_00317812 predicted 1800
9 SASI_Hs02_00317813 predicted 1202
10 SASI_Hs02_00317814 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317815 predicted 1366
2 SASI_Hs02_00317816 predicted 1359
3 SASI_Hs02_00317817 predicted 2133
4 SASI_Hs02_00317818 predicted 1667
5 SASI_Hs02_00317819 predicted 1503
6 SASI_Hs02_00317820 predicted 1445
7 SASI_Hs02_00317821 predicted 1887
8 SASI_Hs02_00317822 predicted 1726
9 SASI_Hs02_00317823 predicted 1128
10 SASI_Hs02_00317824 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317825 predicted 1435
2 SASI_Hs02_00317826 predicted 1435
3 SASI_Hs02_00317827 predicted 2199
4 SASI_Hs02_00317828 predicted 1734
5 SASI_Hs02_00317829 predicted 1573
6 SASI_Hs02_00317830 predicted 1518
7 SASI_Hs02_00317831 predicted 1962
8 SASI_Hs02_00317832 predicted 1800
9 SASI_Hs02_00317833 predicted 1196
10 SASI_Hs02_00317834 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317835 predicted 1243
2 SASI_Hs02_00317836 predicted 1239
3 SASI_Hs02_00317837 predicted 2015
4 SASI_Hs02_00317838 predicted 1540
5 SASI_Hs02_00317839 predicted 1381
6 SASI_Hs02_00317840 predicted 1326
7 SASI_Hs02_00317841 predicted 1776
8 SASI_Hs02_00317842 predicted 1607
9 SASI_Hs02_00317843 predicted 1011
10 SASI_Hs02_00317844 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317845 predicted 950
2 SASI_Hs02_00317846 predicted 955
3 SASI_Hs02_00317847 predicted 1723
4 SASI_Hs02_00317848 predicted 1253
5 SASI_Hs02_00317849 predicted 1091
6 SASI_Hs02_00317850 predicted 1043
7 SASI_Hs02_00317851 predicted 1485
8 SASI_Hs02_00317852 predicted 1317
9 SASI_Hs02_00317853 predicted 718
10 SASI_Hs02_00317854 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317855 predicted 956
2 SASI_Hs02_00317856 predicted 951
3 SASI_Hs02_00317857 predicted 1722
4 SASI_Hs02_00317858 predicted 1257
5 SASI_Hs02_00317859 predicted 1092
6 SASI_Hs02_00317860 predicted 1040
7 SASI_Hs02_00317861 predicted 1483
8 SASI_Hs02_00317862 predicted 1318
9 SASI_Hs02_00317863 predicted 719
10 SASI_Hs02_00317864 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317865 predicted 952
2 SASI_Hs02_00317866 predicted 950
3 SASI_Hs02_00317867 predicted 1718
4 SASI_Hs02_00317868 predicted 1251
5 SASI_Hs02_00317869 predicted 1099
6 SASI_Hs02_00317870 predicted 1038
7 SASI_Hs02_00317871 predicted 1487
8 SASI_Hs02_00317872 predicted 1320
9 SASI_Hs02_00317873 predicted 715
10 SASI_Hs02_00317874 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317875 predicted 954
2 SASI_Hs02_00317876 predicted 957
3 SASI_Hs02_00317877 predicted 1723
4 SASI_Hs02_00317878 predicted 1259
5 SASI_Hs02_00317879 predicted 1090
6 SASI_Hs02_00317880 predicted 1039
7 SASI_Hs02_00317881 predicted 1488
8 SASI_Hs02_00317882 predicted 1313
9 SASI_Hs02_00317883 predicted 723
10 SASI_Hs02_00317884 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317885 predicted 1023
2 SASI_Hs02_00317886 predicted 1025
3 SASI_Hs02_00317887 predicted 1791
4 SASI_Hs02_00317888 predicted 1325
5 SASI_Hs02_00317889 predicted 1165
6 SASI_Hs02_00317890 predicted 1118
7 SASI_Hs02_00317891 predicted 1554
8 SASI_Hs02_00317892 predicted 1391
9 SASI_Hs02_00317893 predicted 795
10 SASI_Hs02_00317894 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317895 predicted 949
2 SASI_Hs02_00317896 predicted 959
3 SASI_Hs02_00317897 predicted 1726
4 SASI_Hs02_00317898 predicted 1255
5 SASI_Hs02_00317899 predicted 1097
6 SASI_Hs02_00317900 predicted 1041
7 SASI_Hs02_00317901 predicted 1487
8 SASI_Hs02_00317902 predicted 1320
9 SASI_Hs02_00317903 predicted 724
10 SASI_Hs02_00317904 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317905 predicted 886
2 SASI_Hs02_00317906 predicted 878
3 SASI_Hs02_00317907 predicted 1645
4 SASI_Hs02_00317908 predicted 1180
5 SASI_Hs02_00317909 predicted 1024
6 SASI_Hs02_00317910 predicted 965
7 SASI_Hs02_00317911 predicted 1409
8 SASI_Hs02_00317912 predicted 1242
9 SASI_Hs02_00317913 predicted 643
10 SASI_Hs02_00317914 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331639 predicted 1437
2 SASI_Hs02_00331640 predicted 1432
3 SASI_Hs02_00331641 predicted 2201
4 SASI_Hs02_00331642 predicted 1741
5 SASI_Hs02_00331643 predicted 1575
6 SASI_Hs01_00010746 predicted 1519
7 SASI_Hs01_00010747 predicted 1964
8 SASI_Hs01_00010748 predicted 1794
9 SASI_Hs02_00331644 predicted 1200
10 SASI_Hs01_00010749 predicted 1399
11 SASI_Hs01_00010741 predicted 993
12 SASI_Hs01_00010742 predicted 1066
13 SASI_Hs01_00010743 predicted 2078
14 SASI_Hs01_00010744 predicted 2242
15 SASI_Hs01_00010745 predicted 2289
16 SASI_Hs01_00010750 predicted 2437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231805 predicted 1173
2 SASI_Rn02_00231806 predicted 1829
3 SASI_Rn02_00231807 predicted 1367
4 SASI_Rn02_00231808 predicted 2606
5 SASI_Rn02_00231809 predicted 1013
6 SASI_Rn02_00231810 predicted 2075
7 SASI_Rn02_00231811 predicted 2838
8 SASI_Rn02_00231812 predicted 2587
9 SASI_Rn02_00231813 predicted 3122
10 SASI_Rn02_00231814 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300442 predicted 1292
2 SASI_Mm02_00300443 predicted 2676
3 SASI_Mm02_00300444 predicted 1075
4 SASI_Mm02_00300445 predicted 1658
5 SASI_Mm02_00300446 predicted 1301
6 SASI_Mm02_00300447 predicted 1424
7 SASI_Mm02_00300448 predicted 2679
8 SASI_Mm02_00300449 predicted 1066
9 SASI_Mm02_00300450 predicted 1381
10 SASI_Mm02_00300451 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300452 predicted 1001
2 SASI_Mm02_00300453 predicted 2370
3 SASI_Mm02_00300454 predicted 782
4 SASI_Mm02_00300455 predicted 1363
5 SASI_Mm02_00300456 predicted 1019
6 SASI_Mm02_00300457 predicted 1138
7 SASI_Mm02_00300458 predicted 2365
8 SASI_Mm02_00300459 predicted 779
9 SASI_Mm02_00300460 predicted 1092
10 SASI_Mm02_00300461 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300462 predicted 1292
2 SASI_Mm02_00300463 predicted 2679
3 SASI_Mm02_00300464 predicted 1076
4 SASI_Mm02_00300465 predicted 1659
5 SASI_Mm02_00300466 predicted 1305
6 SASI_Mm02_00300467 predicted 1426
7 SASI_Mm02_00300468 predicted 2678
8 SASI_Mm02_00300469 predicted 1067
9 SASI_Mm02_00300470 predicted 1383
10 SASI_Mm02_00300471 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300472 predicted 1063
2 SASI_Mm02_00300473 predicted 2427
3 SASI_Mm02_00300474 predicted 845
4 SASI_Mm02_00300475 predicted 1424
5 SASI_Mm02_00300476 predicted 1071
6 SASI_Mm02_00300477 predicted 1192
7 SASI_Mm02_00300478 predicted 2423
8 SASI_Mm02_00300479 predicted 841
9 SASI_Mm02_00300480 predicted 1154
10 SASI_Mm02_00300481 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099345 predicted 1406
2 SASI_Mm02_00312065 predicted 2797
3 SASI_Mm01_00099346 predicted 1194
4 SASI_Mm02_00312066 predicted 1776
5 SASI_Mm01_00099347 predicted 1419
6 SASI_Mm01_00099349 predicted 1541
7 SASI_Mm02_00312067 predicted 2791
8 SASI_Mm02_00312068 predicted 1182
9 SASI_Mm01_00099351 predicted 1500
10 SASI_Mm02_00312069 predicted 1258
11 SASI_Mm01_00099343 predicted 2243
12 SASI_Mm01_00099344 predicted 2285
13 SASI_Mm01_00099348 predicted 2192
14 SASI_Mm01_00099350 predicted 2974
15 SASI_Mm01_00099352 predicted 3015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001331
VALIDATED
CTNND1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), delta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-3597s1c1
Sequence:CCGGCCTGACTCAATTATTTGCATACTCGAGTATGCAAATAATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2346s1c1
Sequence:CCGGGCTCCCAATGTTGCCAACAATCTCGAGATTGTTGGCAACATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-2347s1c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2514s1c1
Sequence:CCGGCGGATATACATCTCACTTCTTCTCGAGAAGAAGTGAGATGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1948s21c1
Sequence:CCGGGCTTCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001331.2-2382s21c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1214s21c1
Sequence:CCGGCGCCACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1191s21c1
Sequence:CCGGACTACCCTCCTGATGGTTATACTCGAGTATAACCATCAGGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001331
VALIDATED
CTNND1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), delta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-3597s1c1
Sequence:CCGGCCTGACTCAATTATTTGCATACTCGAGTATGCAAATAATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2346s1c1
Sequence:CCGGGCTCCCAATGTTGCCAACAATCTCGAGATTGTTGGCAACATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-2347s1c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2514s1c1
Sequence:CCGGCGGATATACATCTCACTTCTTCTCGAGAAGAAGTGAGATGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1948s21c1
Sequence:CCGGGCTTCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001331.2-2382s21c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1214s21c1
Sequence:CCGGCGCCACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1191s21c1
Sequence:CCGGACTACCCTCCTGATGGTTATACTCGAGTATAACCATCAGGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001331
VALIDATED
CTNND1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), delta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-3597s1c1
Sequence:CCGGCCTGACTCAATTATTTGCATACTCGAGTATGCAAATAATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2346s1c1
Sequence:CCGGGCTCCCAATGTTGCCAACAATCTCGAGATTGTTGGCAACATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001331.1-2347s1c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001331.1-2514s1c1
Sequence:CCGGCGGATATACATCTCACTTCTTCTCGAGAAGAAGTGAGATGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1948s21c1
Sequence:CCGGGCTTCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001331.2-2382s21c1
Sequence:CCGGCTCCCAATGTTGCCAACAATACTCGAGTATTGTTGGCAACATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1214s21c1
Sequence:CCGGCGCCACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001331.2-1191s21c1
Sequence:CCGGACTACCCTCCTGATGGTTATACTCGAGTATAACCATCAGGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007615
VALIDATED
CTNND1 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), delta 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-985s1c1
Sequence:CCGGCGACACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2284s1c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-1572s1c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2545s1c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-3996s1c1
Sequence:CCGGCCCATCTCTCTTCGTCCTTTACTCGAGTAAAGGACGAAGAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1777s21c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1924s21c1
Sequence:CCGGGCTCCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-3507s21c1
Sequence:CCGGGCTGCCGTCATCCGTGAATTACTCGAGTAATTCACGGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2507s21c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2768s21c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007615
VALIDATED
CTNND1 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), delta 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-985s1c1
Sequence:CCGGCGACACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2284s1c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-1572s1c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2545s1c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-3996s1c1
Sequence:CCGGCCCATCTCTCTTCGTCCTTTACTCGAGTAAAGGACGAAGAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1777s21c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1924s21c1
Sequence:CCGGGCTCCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-3507s21c1
Sequence:CCGGGCTGCCGTCATCCGTGAATTACTCGAGTAATTCACGGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2507s21c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2768s21c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007615
VALIDATED
CTNND1 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), delta 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-985s1c1
Sequence:CCGGCGACACTATGAAGATGGTTATCTCGAGATAACCATCTTCATAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2284s1c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-1572s1c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-2545s1c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007615.1-3996s1c1
Sequence:CCGGCCCATCTCTCTTCGTCCTTTACTCGAGTAAAGGACGAAGAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1777s21c1
Sequence:CCGGCCCGATATTGGTAGGATTGTTCTCGAGAACAATCCTACCAATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-1924s21c1
Sequence:CCGGGCTCCGAAAGGCTCGTGATATCTCGAGATATCACGAGCCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-3507s21c1
Sequence:CCGGGCTGCCGTCATCCGTGAATTACTCGAGTAATTCACGGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2507s21c1
Sequence:CCGGCGAGGCTATGAACTCTTATTTCTCGAGAAATAAGAGTTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007615.4-2768s21c1
Sequence:CCGGGCTCGGAACAAAGAGTTAATTCTCGAGAATTAACTCTTTGTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks