EMAIL THIS PAGE TO A FRIEND

CTNND2

catenin (cadherin-associated protein), delta 2

202 Gene Product Result for
Synonyms: GT24 NPRAP
Gene ID:
Human(1501) Summary: This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome.[provided by RefSeq, Aug 2010]
Mouse(18163) catenin (cadherin associated protein), delta 2
Rat(114028) catenin (cadherin-associated protein), delta 2
domestic guinea pig(100717814) catenin (cadherin-associated protein), delta 2
naked mole-rat(101726490) catenin (cadherin-associated protein), delta 2
sheep(101121119) catenin (cadherin-associated protein), delta 2
chicken(420922) catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)
cow(523661) catenin (cadherin-associated protein), delta 2
Horse(100070792) catenin (cadherin-associated protein), delta 2
domestic cat(101092165) catenin (cadherin-associated protein), delta 2
dog(488048) catenin (cadherin-associated protein), delta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001332 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013951 MISSION® esiRNA esiRNA targeting mouse Ctnnd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001332 Rosetta Predictions human pricing
XM_001064375 Rosetta Predictions rat pricing
XM_001065606 Rosetta Predictions rat pricing
XM_226897 Rosetta Predictions rat pricing
NM_008729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147132 predicted 3712
2 SASI_Hs01_00147133 predicted 1391
3 SASI_Hs01_00147134 predicted 3901
4 SASI_Hs01_00147135 predicted 1662
5 SASI_Hs01_00147136 predicted 3499
6 SASI_Hs01_00147137 predicted 382
7 SASI_Hs01_00147138 predicted 3228
8 SASI_Hs01_00147139 predicted 482
9 SASI_Hs01_00147140 predicted 2667
10 SASI_Hs01_00147141 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310214 predicted 3505
2 SASI_Rn02_00310215 predicted 1597
3 SASI_Rn02_00310216 predicted 3215
4 SASI_Rn02_00310217 predicted 2388
5 SASI_Rn02_00310218 predicted 2234
6 SASI_Rn02_00310219 predicted 457
7 SASI_Rn02_00310220 predicted 308
8 SASI_Rn02_00310221 predicted 1352
9 SASI_Rn02_00310222 predicted 3440
10 SASI_Rn02_00310223 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314814 predicted 3567
2 SASI_Rn02_00314815 predicted 1656
3 SASI_Rn02_00314816 predicted 3272
4 SASI_Rn02_00314817 predicted 2451
5 SASI_Rn02_00314818 predicted 2296
6 SASI_Rn02_00314819 predicted 461
7 SASI_Rn02_00314820 predicted 304
8 SASI_Rn02_00314821 predicted 1403
9 SASI_Rn02_00314822 predicted 3499
10 SASI_Rn02_00314823 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137169 predicted 3918
2 SASI_Rn01_00137170 predicted 3060
3 SASI_Rn01_00137171 predicted 6653
4 SASI_Rn01_00137172 predicted 962
5 SASI_Rn01_00137173 predicted 3037
6 SASI_Rn01_00137174 predicted 2785
7 SASI_Rn01_00137175 predicted 7174
8 SASI_Rn01_00137176 predicted 5096
9 SASI_Rn01_00137177 predicted 1123
10 SASI_Rn01_00137178 predicted 6161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065950 predicted 3881
2 SASI_Mm01_00065951 predicted 2601
3 SASI_Mm01_00065952 predicted 2034
4 SASI_Mm01_00065953 predicted 3586
5 SASI_Mm01_00065954 predicted 3671
6 SASI_Mm01_00065955 predicted 3383
7 SASI_Mm01_00065956 predicted 2297
8 SASI_Mm01_00065957 predicted 858
9 SASI_Mm01_00065958 predicted 2231
10 SASI_Mm02_00314583 predicted 2677
11 SASI_Mm01_00065959 predicted 1989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008729
CTNND2 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), delta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008729.1-4693s1c1
Sequence:CCGGCGCTTTGTTTACTCTCTTCATCTCGAGATGAAGAGAGTAAACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2182s1c1
Sequence:CCGGCCTGAAGTGATACAGATGTTACTCGAGTAACATCTGTATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2181s1c1
Sequence:CCGGGCCTGAAGTGATACAGATGTTCTCGAGAACATCTGTATCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-631s1c1
Sequence:CCGGCCAGGCTTAAACACCTCCAATCTCGAGATTGGAGGTGTTTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-4212s1c1
Sequence:CCGGCCGTCCTTACAGTGAACTGAACTCGAGTTCAGTTCACTGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008729
CTNND2 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), delta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008729.1-4693s1c1
Sequence:CCGGCGCTTTGTTTACTCTCTTCATCTCGAGATGAAGAGAGTAAACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2182s1c1
Sequence:CCGGCCTGAAGTGATACAGATGTTACTCGAGTAACATCTGTATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2181s1c1
Sequence:CCGGGCCTGAAGTGATACAGATGTTCTCGAGAACATCTGTATCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-631s1c1
Sequence:CCGGCCAGGCTTAAACACCTCCAATCTCGAGATTGGAGGTGTTTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-4212s1c1
Sequence:CCGGCCGTCCTTACAGTGAACTGAACTCGAGTTCAGTTCACTGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008729
CTNND2 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), delta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008729.1-4693s1c1
Sequence:CCGGCGCTTTGTTTACTCTCTTCATCTCGAGATGAAGAGAGTAAACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2182s1c1
Sequence:CCGGCCTGAAGTGATACAGATGTTACTCGAGTAACATCTGTATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-2181s1c1
Sequence:CCGGGCCTGAAGTGATACAGATGTTCTCGAGAACATCTGTATCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-631s1c1
Sequence:CCGGCCAGGCTTAAACACCTCCAATCTCGAGATTGGAGGTGTTTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008729.1-4212s1c1
Sequence:CCGGCCGTCCTTACAGTGAACTGAACTCGAGTTCAGTTCACTGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001332
CTNND2 MISSION shRNA Bacterial Glycerol Stock
catenin (cadherin-associated protein), delta 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2234s1c1
Sequence:CCGGCCTCTTCAGGATGATCGGAAACTCGAGTTTCCGATCATCCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-3761s1c1
Sequence:CCGGCCCTACAGTGAACTGAACTATCTCGAGATAGTTCAGTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-608s1c1
Sequence:CCGGGCACTTCAGCTCAATTCCAAACTCGAGTTTGGAATTGAGCTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2911s1c1
Sequence:CCGGCGTCAGAAATAAGGAGCTCATCTCGAGATGAGCTCCTTATTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001332.2-4521s1c1
Sequence:CCGGGCAGTATTGTTCGTTCTGATACTCGAGTATCAGAACGAACAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001332
CTNND2 MISSION shRNA shRNA Plasmid DNA
catenin (cadherin-associated protein), delta 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2234s1c1
Sequence:CCGGCCTCTTCAGGATGATCGGAAACTCGAGTTTCCGATCATCCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-3761s1c1
Sequence:CCGGCCCTACAGTGAACTGAACTATCTCGAGATAGTTCAGTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-608s1c1
Sequence:CCGGGCACTTCAGCTCAATTCCAAACTCGAGTTTGGAATTGAGCTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2911s1c1
Sequence:CCGGCGTCAGAAATAAGGAGCTCATCTCGAGATGAGCTCCTTATTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001332.2-4521s1c1
Sequence:CCGGGCAGTATTGTTCGTTCTGATACTCGAGTATCAGAACGAACAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001332
CTNND2 MISSION shRNA Lentiviral Transduction Particles
catenin (cadherin-associated protein), delta 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2234s1c1
Sequence:CCGGCCTCTTCAGGATGATCGGAAACTCGAGTTTCCGATCATCCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-3761s1c1
Sequence:CCGGCCCTACAGTGAACTGAACTATCTCGAGATAGTTCAGTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-608s1c1
Sequence:CCGGGCACTTCAGCTCAATTCCAAACTCGAGTTTGGAATTGAGCTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001332.2-2911s1c1
Sequence:CCGGCGTCAGAAATAAGGAGCTCATCTCGAGATGAGCTCCTTATTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001332.2-4521s1c1
Sequence:CCGGGCAGTATTGTTCGTTCTGATACTCGAGTATCAGAACGAACAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks