EMAIL THIS PAGE TO A FRIEND

CTNS

cystinosin, lysosomal cystine transporter

Synonyms: CTNS-LSB PQLC4
UniProtKB ID: O60931, D3DTJ5, Q8IZ01, Q9UNK6
Gene ID:
Human(1497) Summary: This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Mouse(83429) cystinosis, nephropathic
Rat(287478) cystinosin, lysosomal cystine transporter
Zebrafish(553594) cystinosis, nephropathic
chicken(417606) cystinosin, lysosomal cystine transporter
domestic cat(101092308) cystinosin, lysosomal cystine transporter
cow(613527) cystinosin, lysosomal cystine transporter
Horse(100060554) cystinosin, lysosomal cystine transporter
dog(491220) cystinosin, lysosomal cystine transporter
sheep(101122533) cystinosin, lysosomal cystine transporter
naked mole-rat(101721174) cystinosin, lysosomal cystine transporter
domestic guinea pig(100731558) cystinosin, lysosomal cystine transporter
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031681 Rosetta Predictions human pricing
NM_004937 Rosetta Predictions human pricing
XM_001080248 Rosetta Predictions rat pricing
XM_220649 Rosetta Predictions rat pricing
NM_031251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307679 predicted 845
2 SASI_Hs02_00307680 predicted 541
3 SASI_Hs01_00067561 predicted 525
4 SASI_Hs02_00307681 predicted 1822
5 SASI_Hs02_00307682 predicted 929
6 SASI_Hs02_00307683 predicted 1797
7 SASI_Hs02_00307684 predicted 956
8 SASI_Hs02_00307685 predicted 832
9 SASI_Hs02_00307686 predicted 1885
10 SASI_Hs02_00307687 predicted 831
11 SASI_Hs01_00067554 predicted 1099
12 SASI_Hs01_00067555 predicted 543
13 SASI_Hs01_00067556 predicted 1110
14 SASI_Hs01_00067557 predicted 1231
15 SASI_Hs01_00067558 predicted 967
16 SASI_Hs01_00067559 predicted 790
17 SASI_Hs01_00067560 predicted 615
18 SASI_Hs01_00067562 predicted 844
19 SASI_Hs01_00067563 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022572 predicted 1222
2 SASI_Hs01_00022573 predicted 672
3 SASI_Hs01_00022574 predicted 1232
4 SASI_Hs01_00022577 predicted 922
5 SASI_Hs01_00022576 predicted 1099
6 SASI_Hs01_00022578 predicted 738
7 SASI_Hs02_00338607 predicted 1365
8 SASI_Hs01_00022579 predicted 647
9 SASI_Hs01_00022580 predicted 977
10 SASI_Hs02_00338608 predicted 1051
11 SASI_Hs01_00022575 predicted 1117
12 SASI_Hs01_00022581 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367276 predicted 454
2 SASI_Rn02_00367277 predicted 664
3 SASI_Rn02_00367278 predicted 364
4 SASI_Rn02_00367279 predicted 432
5 SASI_Rn02_00367280 predicted 446
6 SASI_Rn02_00367281 predicted 409
7 SASI_Rn02_00367282 predicted 243
8 SASI_Rn02_00367283 predicted 1039
9 SASI_Rn02_00367284 predicted 625
10 SASI_Rn02_00367285 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379491 predicted 387
2 SASI_Rn02_00379492 predicted 596
3 SASI_Rn02_00379493 predicted 296
4 SASI_Rn02_00379494 predicted 359
5 SASI_Rn02_00379495 predicted 477
6 SASI_Rn02_00379496 predicted 379
7 SASI_Rn02_00379497 predicted 342
8 SASI_Rn02_00379498 predicted 972
9 SASI_Rn02_00379499 predicted 936
10 SASI_Rn02_00379500 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128010 predicted 496
2 SASI_Mm01_00128011 predicted 475
3 SASI_Mm02_00337075 predicted 960
4 SASI_Mm01_00128013 predicted 1088
5 SASI_Mm01_00128014 predicted 665
6 SASI_Mm01_00128015 predicted 871
7 SASI_Mm01_00128016 predicted 1048
8 SASI_Mm01_00128017 predicted 295
9 SASI_Mm01_00128018 predicted 1068
10 SASI_Mm02_00337076 predicted 487
11 SASI_Mm01_00128009 predicted 603
12 SASI_Mm01_00128012 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031251
VALIDATED
CTNS MISSION shRNA Bacterial Glycerol Stock
cystinosin, lysosomal cystine transporter
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031251.2-1992s1c1
Sequence:CCGGGCACACAAAGATACCACAGTACTCGAGTACTGTGGTATCTTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031251.2-263s1c1
Sequence:CCGGGCATCCACTAAATTCGACCTTCTCGAGAAGGTCGAATTTAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-482s1c1
Sequence:CCGGCAGAATCGTTAGCATCATAAACTCGAGTTTATGATGCTAACGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-1076s1c1
Sequence:CCGGCCAGTCTTACAATAATGACCACTCGAGTGGTCATTATTGTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-481s1c1
Sequence:CCGGGCAGAATCGTTAGCATCATAACTCGAGTTATGATGCTAACGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1476s21c1
Sequence:CCGGGGCAGTCTCTCCCAACTTTAACTCGAGTTAAAGTTGGGAGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-331s21c1
Sequence:CCGGGGAGCTTCCTGATGAAGTTATCTCGAGATAACTTCATCAGGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-1204s21c1
Sequence:CCGGAGGGTACGACCAGTTGAATTACTCGAGTAATTCAACTGGTCGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-945s21c1
Sequence:CCGGTCATCACACTGATCAAGTATTCTCGAGAATACTTGATCAGTGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-456s21c1
Sequence:CCGGGGATCCGGTTCTTGGTGATACCTCGAGGTATCACCAAGAACCGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1263s21c1
Sequence:CCGGCCTGGTAGGAAAGGTTGTATCCTCGAGGATACAACCTTTCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031251
VALIDATED
CTNS MISSION shRNA shRNA Plasmid DNA
cystinosin, lysosomal cystine transporter
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031251.2-1992s1c1
Sequence:CCGGGCACACAAAGATACCACAGTACTCGAGTACTGTGGTATCTTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031251.2-263s1c1
Sequence:CCGGGCATCCACTAAATTCGACCTTCTCGAGAAGGTCGAATTTAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-482s1c1
Sequence:CCGGCAGAATCGTTAGCATCATAAACTCGAGTTTATGATGCTAACGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-1076s1c1
Sequence:CCGGCCAGTCTTACAATAATGACCACTCGAGTGGTCATTATTGTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-481s1c1
Sequence:CCGGGCAGAATCGTTAGCATCATAACTCGAGTTATGATGCTAACGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1476s21c1
Sequence:CCGGGGCAGTCTCTCCCAACTTTAACTCGAGTTAAAGTTGGGAGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-331s21c1
Sequence:CCGGGGAGCTTCCTGATGAAGTTATCTCGAGATAACTTCATCAGGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-1204s21c1
Sequence:CCGGAGGGTACGACCAGTTGAATTACTCGAGTAATTCAACTGGTCGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-945s21c1
Sequence:CCGGTCATCACACTGATCAAGTATTCTCGAGAATACTTGATCAGTGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-456s21c1
Sequence:CCGGGGATCCGGTTCTTGGTGATACCTCGAGGTATCACCAAGAACCGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1263s21c1
Sequence:CCGGCCTGGTAGGAAAGGTTGTATCCTCGAGGATACAACCTTTCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031251
VALIDATED
CTNS MISSION shRNA Lentiviral Transduction Particles
cystinosin, lysosomal cystine transporter
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031251.2-1992s1c1
Sequence:CCGGGCACACAAAGATACCACAGTACTCGAGTACTGTGGTATCTTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031251.2-263s1c1
Sequence:CCGGGCATCCACTAAATTCGACCTTCTCGAGAAGGTCGAATTTAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-482s1c1
Sequence:CCGGCAGAATCGTTAGCATCATAAACTCGAGTTTATGATGCTAACGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-1076s1c1
Sequence:CCGGCCAGTCTTACAATAATGACCACTCGAGTGGTCATTATTGTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031251.2-481s1c1
Sequence:CCGGGCAGAATCGTTAGCATCATAACTCGAGTTATGATGCTAACGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1476s21c1
Sequence:CCGGGGCAGTCTCTCCCAACTTTAACTCGAGTTAAAGTTGGGAGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-331s21c1
Sequence:CCGGGGAGCTTCCTGATGAAGTTATCTCGAGATAACTTCATCAGGAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-1204s21c1
Sequence:CCGGAGGGTACGACCAGTTGAATTACTCGAGTAATTCAACTGGTCGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-945s21c1
Sequence:CCGGTCATCACACTGATCAAGTATTCTCGAGAATACTTGATCAGTGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031251.4-456s21c1
Sequence:CCGGGGATCCGGTTCTTGGTGATACCTCGAGGTATCACCAAGAACCGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031251.4-1263s21c1
Sequence:CCGGCCTGGTAGGAAAGGTTGTATCCTCGAGGATACAACCTTTCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004937
VALIDATED
CTNS MISSION shRNA Bacterial Glycerol Stock
cystinosin, lysosomal cystine transporter
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-698s1c1
Sequence:CCGGGCAGCGCCATTAGCATCATAACTCGAGTTATGATGCTAATGGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-1186s1c1
Sequence:CCGGCCACAGGCCTACATGAACTTTCTCGAGAAAGTTCATGTAGGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-619s1c1
Sequence:CCGGGTTGGACAACTTACTGTTTATCTCGAGATAAACAGTAAGTTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-480s1c1
Sequence:CCGGGCCACCATTAAATGCAACCCTCTCGAGAGGGTTGCATTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-849s1c1
Sequence:CCGGCGTGGCCTACAGTGTATTCAACTCGAGTTGAATACACTGTAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-979s21c1
Sequence:CCGGTGATTGGCTGGATCTACTTTGCTCGAGCAAAGTAGATCCAGCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-631s21c1
Sequence:CCGGCCCTGAAGCTCGTAGAGAAATCTCGAGATTTCTCTACGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1417s21c1
Sequence:CCGGCAGTCACGCTGGTCAAGTATTCTCGAGAATACTTGACCAGCGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-671s21c1
Sequence:CCGGCACTGTTCCTCCTGTCGTAAACTCGAGTTTACGACAGGAGGAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1154s21c1
Sequence:CCGGGGAGCAGTTTCTCCTCAAATACTCGAGTATTTGAGGAGAAACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004937
VALIDATED
CTNS MISSION shRNA shRNA Plasmid DNA
cystinosin, lysosomal cystine transporter
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-698s1c1
Sequence:CCGGGCAGCGCCATTAGCATCATAACTCGAGTTATGATGCTAATGGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-1186s1c1
Sequence:CCGGCCACAGGCCTACATGAACTTTCTCGAGAAAGTTCATGTAGGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-619s1c1
Sequence:CCGGGTTGGACAACTTACTGTTTATCTCGAGATAAACAGTAAGTTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-480s1c1
Sequence:CCGGGCCACCATTAAATGCAACCCTCTCGAGAGGGTTGCATTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-849s1c1
Sequence:CCGGCGTGGCCTACAGTGTATTCAACTCGAGTTGAATACACTGTAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-979s21c1
Sequence:CCGGTGATTGGCTGGATCTACTTTGCTCGAGCAAAGTAGATCCAGCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-631s21c1
Sequence:CCGGCCCTGAAGCTCGTAGAGAAATCTCGAGATTTCTCTACGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1417s21c1
Sequence:CCGGCAGTCACGCTGGTCAAGTATTCTCGAGAATACTTGACCAGCGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-671s21c1
Sequence:CCGGCACTGTTCCTCCTGTCGTAAACTCGAGTTTACGACAGGAGGAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1154s21c1
Sequence:CCGGGGAGCAGTTTCTCCTCAAATACTCGAGTATTTGAGGAGAAACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004937
VALIDATED
CTNS MISSION shRNA Lentiviral Transduction Particles
cystinosin, lysosomal cystine transporter
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-698s1c1
Sequence:CCGGGCAGCGCCATTAGCATCATAACTCGAGTTATGATGCTAATGGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-1186s1c1
Sequence:CCGGCCACAGGCCTACATGAACTTTCTCGAGAAAGTTCATGTAGGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-619s1c1
Sequence:CCGGGTTGGACAACTTACTGTTTATCTCGAGATAAACAGTAAGTTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004937.1-480s1c1
Sequence:CCGGGCCACCATTAAATGCAACCCTCTCGAGAGGGTTGCATTTAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004937.1-849s1c1
Sequence:CCGGCGTGGCCTACAGTGTATTCAACTCGAGTTGAATACACTGTAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-979s21c1
Sequence:CCGGTGATTGGCTGGATCTACTTTGCTCGAGCAAAGTAGATCCAGCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-631s21c1
Sequence:CCGGCCCTGAAGCTCGTAGAGAAATCTCGAGATTTCTCTACGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1417s21c1
Sequence:CCGGCAGTCACGCTGGTCAAGTATTCTCGAGAATACTTGACCAGCGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-671s21c1
Sequence:CCGGCACTGTTCCTCCTGTCGTAAACTCGAGTTTACGACAGGAGGAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004937.2-1154s21c1
Sequence:CCGGGGAGCAGTTTCTCCTCAAATACTCGAGTATTTGAGGAGAAACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks