EMAIL THIS PAGE TO A FRIEND

CTPS1

CTP synthase 1

34 Gene Product Result for
Synonyms: CTPS
UniProtKB ID: P17812, D3DPW1, Q5VW67, Q96GK6
Gene ID:
Human(1503) Summary: The catalytic conversion of UTP to CTP is accomplished by the enzyme cytidine-5-prime-triphosphate synthetase. The enzyme is important in the biosynthesis of phospholipids and nucleic acids, and plays a key role in cell growth, development, and tumorigenesis. The region to which the CTPS gene has been mapped is the location of breakpoints involved in several tumor types [provided by RefSeq, Jul 2008]
Rat(313560) CTP synthase 1
domestic cat(101100066) CTP synthase 1
sheep(101103276) CTP synthase 1
naked mole-rat(101715236) CTP synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001905 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130661 MISSION® esiRNA esiRNA human CTPS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001905 Rosetta Predictions human pricing
NM_001134873 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332780 predicted 1205
2 SASI_Hs01_00011528 predicted 655
3 SASI_Hs01_00011529 predicted 1378
4 SASI_Hs01_00011530 predicted 1478
5 SASI_Hs01_00011531 predicted 875
6 SASI_Hs01_00011532 predicted 1902
7 SASI_Hs01_00011533 predicted 959
8 SASI_Hs01_00011534 predicted 885
9 SASI_Hs01_00011536 predicted 1307
10 SASI_Hs01_00011537 predicted 1657
11 SASI_Hs01_00011535 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258894 predicted 717
2 SASI_Rn02_00258895 predicted 212
3 SASI_Rn02_00258896 predicted 1890
4 SASI_Rn02_00258897 predicted 775
5 SASI_Rn02_00258898 predicted 495
6 SASI_Rn02_00258899 predicted 720
7 SASI_Rn02_00258900 predicted 1054
8 SASI_Rn02_00258901 predicted 1098
9 SASI_Rn02_00258902 predicted 752
10 SASI_Rn02_00258903 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001905
VALIDATED
CTPS1 MISSION shRNA Bacterial Glycerol Stock
CTP synthase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-417s1c1
Sequence:CCGGCCCTCATATCACAGATGCAATCTCGAGATTGCATCTGTGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-460s1c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001905.1-835s1c1
Sequence:CCGGCCCTTGTTGTTAGAGGAGCAACTCGAGTTGCTCCTCTAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-1725s1c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-749s21c1
Sequence:CCGGCGCCTCACCAAGGACAATAATCTCGAGATTATTGTCCTTGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001905.2-2581s21c1
Sequence:CCGGCTCAACTACCTCGCATCATTGCTCGAGCAATGATGCGAGGTAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001905.2-711s21c1
Sequence:CCGGACCTTGACCTGGGTAACTATGCTCGAGCATAGTTACCCAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2158s21c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-893s21c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2282s21c1
Sequence:CCGGTGATCTTGTAGCGGATGATTCCTCGAGGAATCATCCGCTACAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001905
VALIDATED
CTPS1 MISSION shRNA shRNA Plasmid DNA
CTP synthase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-417s1c1
Sequence:CCGGCCCTCATATCACAGATGCAATCTCGAGATTGCATCTGTGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-460s1c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001905.1-835s1c1
Sequence:CCGGCCCTTGTTGTTAGAGGAGCAACTCGAGTTGCTCCTCTAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-1725s1c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-749s21c1
Sequence:CCGGCGCCTCACCAAGGACAATAATCTCGAGATTATTGTCCTTGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001905.2-2581s21c1
Sequence:CCGGCTCAACTACCTCGCATCATTGCTCGAGCAATGATGCGAGGTAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001905.2-711s21c1
Sequence:CCGGACCTTGACCTGGGTAACTATGCTCGAGCATAGTTACCCAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2158s21c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-893s21c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2282s21c1
Sequence:CCGGTGATCTTGTAGCGGATGATTCCTCGAGGAATCATCCGCTACAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001905
VALIDATED
CTPS1 MISSION shRNA Lentiviral Transduction Particles
CTP synthase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-417s1c1
Sequence:CCGGCCCTCATATCACAGATGCAATCTCGAGATTGCATCTGTGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-460s1c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001905.1-835s1c1
Sequence:CCGGCCCTTGTTGTTAGAGGAGCAACTCGAGTTGCTCCTCTAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001905.1-1725s1c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-749s21c1
Sequence:CCGGCGCCTCACCAAGGACAATAATCTCGAGATTATTGTCCTTGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001905.2-2581s21c1
Sequence:CCGGCTCAACTACCTCGCATCATTGCTCGAGCAATGATGCGAGGTAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001905.2-711s21c1
Sequence:CCGGACCTTGACCTGGGTAACTATGCTCGAGCATAGTTACCCAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2158s21c1
Sequence:CCGGGCTCTCACATTACCTCCAGAACTCGAGTTCTGGAGGTAATGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-893s21c1
Sequence:CCGGGCGTTAATACCTGTAGATGAACTCGAGTTCATCTACAGGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001905.2-2282s21c1
Sequence:CCGGTGATCTTGTAGCGGATGATTCCTCGAGGAATCATCCGCTACAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks