EMAIL THIS PAGE TO A FRIEND

CTPS2

CTP synthase 2

UniProtKB ID: Q9NRF8, B3KWM2, Q9BRI0, Q9H809, Q9H8K9
Gene ID:
Human(56474) Summary: The protein encoded by this gene catalyzes the formation of CTP from UTP with the concomitant deamination of glutamine to glutamate. This protein is the rate-limiting enzyme in the synthesis of cytosine nucleotides, which play an important role in various metabolic processes and provide the precursors necessary for the synthesis of RNA and DNA. Cancer cells that exhibit increased cell proliferation also exhibit an increased activity of this encoded protein. Thus, this protein is an attractive target for selective chemotherapy. Three alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jan 2009]
Mouse(55936) cytidine 5'-triphosphate synthase 2
Rat(619580) CTP synthase 2
chicken(418620) CTP synthase II
domestic cat(101097209) CTP synthase 2
cow(767849) CTP synthase II
dog(480851) CTP synthase 2
naked mole-rat(101704664) CTP synthase 2
sheep(101105631) CTP synthase 2
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019857 Rosetta Predictions human pricing
NM_175859 Rosetta Predictions human pricing
NM_001034998 Rosetta Predictions rat pricing
NM_018737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115750 predicted 1706
2 SASI_Hs01_00115751 predicted 1230
3 SASI_Hs01_00115752 predicted 1500
4 SASI_Hs01_00115753 predicted 883
5 SASI_Hs02_00352884 predicted 1466
6 SASI_Hs01_00115754 predicted 745
7 SASI_Hs01_00115755 predicted 1603
8 SASI_Hs01_00115756 predicted 1773
9 SASI_Hs02_00352885 predicted 2060
10 SASI_Hs01_00115758 predicted 1930
11 SASI_Hs01_00115749 predicted 1481
12 SASI_Hs01_00115757 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044506 predicted 1810
2 SASI_Hs01_00044507 predicted 1328
3 SASI_Hs01_00044508 predicted 1602
4 SASI_Hs01_00044509 predicted 984
5 SASI_Hs02_00369134 predicted 1569
6 SASI_Hs01_00044510 predicted 847
7 SASI_Hs01_00044511 predicted 1700
8 SASI_Hs01_00044512 predicted 1883
9 SASI_Hs02_00369135 predicted 2159
10 SASI_Hs01_00044514 predicted 2026
11 SASI_Hs01_00044505 predicted 1584
12 SASI_Hs01_00044513 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076285 predicted 1478
2 SASI_Rn01_00076286 predicted 800
3 SASI_Rn01_00076287 predicted 1410
4 SASI_Rn01_00076288 predicted 714
5 SASI_Rn01_00076289 predicted 1617
6 SASI_Rn01_00076290 predicted 1274
7 SASI_Rn01_00076291 predicted 886
8 SASI_Rn01_00076292 predicted 1610
9 SASI_Rn01_00076293 predicted 1762
10 SASI_Rn01_00076294 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188360 predicted 1477
2 SASI_Mm01_00188361 predicted 954
3 SASI_Mm02_00323988 predicted 1629
4 SASI_Mm02_00323989 predicted 301
5 SASI_Mm01_00188363 predicted 900
6 SASI_Mm01_00188364 predicted 308
7 SASI_Mm01_00188365 predicted 231
8 SASI_Mm01_00188366 predicted 1870
9 SASI_Mm01_00188367 predicted 1267
10 SASI_Mm01_00188368 predicted 1249
11 SASI_Mm01_00188359 predicted 298
12 SASI_Mm01_00188362 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019857
CTPS2 MISSION shRNA Bacterial Glycerol Stock
CTP synthase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-644s21c1
Sequence:CCGGGGTGCCGGTGGATGGTAATAACTCGAGTTATTACCATCCACCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-1541s21c1
Sequence:CCGGAGTTCCTCTGGTGATTGATATCTCGAGATATCAATCACCAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-338s21c1
Sequence:CCGGATCATGTGGACTCCGAGTTACCTCGAGGTAACTCGGAGTCCACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-292s21c1
Sequence:CCGGGCATTGGTAAAGGGATCATTGCTCGAGCAATGATCCCTTTACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-419s1c1
Sequence:CCGGCGGTGAAGTCTTCGTCTTAAACTCGAGTTTAAGACGAAGACTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-738s1c1
Sequence:CCGGGCGTTTAGACAATTCCAGTTTCTCGAGAAACTGGAATTGTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1233s1c1
Sequence:CCGGGCCATCAACCACAAGTTGAATCTCGAGATTCAACTTGTGGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1930s1c1
Sequence:CCGGGCAAACTGTCTTCCAGTGATACTCGAGTATCACTGGAAGACAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1323s1c1
Sequence:CCGGGCTTGGCAGAAGCTATGCAAACTCGAGTTTGCATAGCTTCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019857
CTPS2 MISSION shRNA shRNA Plasmid DNA
CTP synthase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-644s21c1
Sequence:CCGGGGTGCCGGTGGATGGTAATAACTCGAGTTATTACCATCCACCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-1541s21c1
Sequence:CCGGAGTTCCTCTGGTGATTGATATCTCGAGATATCAATCACCAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-338s21c1
Sequence:CCGGATCATGTGGACTCCGAGTTACCTCGAGGTAACTCGGAGTCCACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-292s21c1
Sequence:CCGGGCATTGGTAAAGGGATCATTGCTCGAGCAATGATCCCTTTACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-419s1c1
Sequence:CCGGCGGTGAAGTCTTCGTCTTAAACTCGAGTTTAAGACGAAGACTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-738s1c1
Sequence:CCGGGCGTTTAGACAATTCCAGTTTCTCGAGAAACTGGAATTGTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1233s1c1
Sequence:CCGGGCCATCAACCACAAGTTGAATCTCGAGATTCAACTTGTGGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1930s1c1
Sequence:CCGGGCAAACTGTCTTCCAGTGATACTCGAGTATCACTGGAAGACAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1323s1c1
Sequence:CCGGGCTTGGCAGAAGCTATGCAAACTCGAGTTTGCATAGCTTCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019857
CTPS2 MISSION shRNA Lentiviral Transduction Particles
CTP synthase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-644s21c1
Sequence:CCGGGGTGCCGGTGGATGGTAATAACTCGAGTTATTACCATCCACCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-1541s21c1
Sequence:CCGGAGTTCCTCTGGTGATTGATATCTCGAGATATCAATCACCAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-338s21c1
Sequence:CCGGATCATGTGGACTCCGAGTTACCTCGAGGTAACTCGGAGTCCACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019857.3-292s21c1
Sequence:CCGGGCATTGGTAAAGGGATCATTGCTCGAGCAATGATCCCTTTACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-419s1c1
Sequence:CCGGCGGTGAAGTCTTCGTCTTAAACTCGAGTTTAAGACGAAGACTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-738s1c1
Sequence:CCGGGCGTTTAGACAATTCCAGTTTCTCGAGAAACTGGAATTGTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1233s1c1
Sequence:CCGGGCCATCAACCACAAGTTGAATCTCGAGATTCAACTTGTGGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1930s1c1
Sequence:CCGGGCAAACTGTCTTCCAGTGATACTCGAGTATCACTGGAAGACAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019857.3-1323s1c1
Sequence:CCGGGCTTGGCAGAAGCTATGCAAACTCGAGTTTGCATAGCTTCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018737
VALIDATED
CTPS2 MISSION shRNA Bacterial Glycerol Stock
CTP synthase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-984s21c1
Sequence:CCGGCATAGCCCTGGTTGGTAAATACTCGAGTATTTACCAACCAGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-112s21c1
Sequence:CCGGGTCATCTCAGGCATTGGTAAACTCGAGTTTACCAATGCCTGAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018737.4-294s21c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1958s21c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1623s21c1
Sequence:CCGGGTTGACAAGTCATCCATATTTCTCGAGAAATATGGATGACTTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-223s21c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-2149s1c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-1093s1c1
Sequence:CCGGCCATCAATGATTGTTCAAGTACTCGAGTACTTGAACAATCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018737.2-1955s1c1
Sequence:CCGGGCTGCCATACAGTGATGGATACTCGAGTATCCATCACTGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-485s1c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-414s1c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018737
VALIDATED
CTPS2 MISSION shRNA shRNA Plasmid DNA
CTP synthase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-984s21c1
Sequence:CCGGCATAGCCCTGGTTGGTAAATACTCGAGTATTTACCAACCAGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-112s21c1
Sequence:CCGGGTCATCTCAGGCATTGGTAAACTCGAGTTTACCAATGCCTGAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018737.4-294s21c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1958s21c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1623s21c1
Sequence:CCGGGTTGACAAGTCATCCATATTTCTCGAGAAATATGGATGACTTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-223s21c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-2149s1c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-1093s1c1
Sequence:CCGGCCATCAATGATTGTTCAAGTACTCGAGTACTTGAACAATCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018737.2-1955s1c1
Sequence:CCGGGCTGCCATACAGTGATGGATACTCGAGTATCCATCACTGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-485s1c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-414s1c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018737
VALIDATED
CTPS2 MISSION shRNA Lentiviral Transduction Particles
CTP synthase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-984s21c1
Sequence:CCGGCATAGCCCTGGTTGGTAAATACTCGAGTATTTACCAACCAGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-112s21c1
Sequence:CCGGGTCATCTCAGGCATTGGTAAACTCGAGTTTACCAATGCCTGAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018737.4-294s21c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1958s21c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-1623s21c1
Sequence:CCGGGTTGACAAGTCATCCATATTTCTCGAGAAATATGGATGACTTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018737.4-223s21c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-2149s1c1
Sequence:CCGGGCTGTGAAGATTCAAAGAGAACTCGAGTTCTCTTTGAATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-1093s1c1
Sequence:CCGGCCATCAATGATTGTTCAAGTACTCGAGTACTTGAACAATCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018737.2-1955s1c1
Sequence:CCGGGCTGCCATACAGTGATGGATACTCGAGTATCCATCACTGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-485s1c1
Sequence:CCGGCCTTGGAAACTATGAAAGATTCTCGAGAATCTTTCATAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018737.2-414s1c1
Sequence:CCGGGCTGGAACTTTCTCACCTTATCTCGAGATAAGGTGAGAAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks