EMAIL THIS PAGE TO A FRIEND

CTR9

CTR9, Paf1/RNA polymerase II complex component

87 Gene Product Result for
Synonyms: SH2BP1 TSBP p150 p150TSP
UniProtKB ID: Q6PD62, D3DQV8, Q15015
Gene ID:
Human(9646) Summary: CTR9, parafibromin (CDC73; MIM 607393), LEO1 (MIM 610507), and PAF1 (MIM 610506) form the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A (MIM 180660) and with a histone methyltransferase complex (Rozenblatt-Rosen et al., 2005 [PubMed 15632063]
Mouse(22083) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Rat(293184) CTR9, Paf1/RNA polymerase II complex component
Zebrafish(100036549) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
cow(534265) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Horse(100147289) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
chicken(423035) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
dog(476853) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic cat(101093139) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
sheep(101123659) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Domestic Rabbit(100348460) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic guinea pig(100734330) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
naked mole-rat(101709165) Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014633 Rosetta Predictions human pricing
XM_001077817 Rosetta Predictions rat pricing
XM_238127 Rosetta Predictions rat pricing
NM_009431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345935 predicted 232
2 SASI_Hs02_00345936 predicted 1461
3 SASI_Hs01_00213223 predicted 489
4 SASI_Hs01_00213226 predicted 3653
5 SASI_Hs02_00345937 predicted 3455
6 SASI_Hs01_00213229 predicted 200
7 SASI_Hs01_00213230 predicted 1441
8 SASI_Hs01_00213231 predicted 1824
9 SASI_Hs01_00213232 predicted 938
10 SASI_Hs02_00345938 predicted 1324
11 SASI_Hs01_00213224 predicted 1882
12 SASI_Hs01_00213225 predicted 430
13 SASI_Hs01_00213227 predicted 1439
14 SASI_Hs01_00213228 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358652 predicted 1865
2 SASI_Rn02_00358653 predicted 746
3 SASI_Rn02_00358654 predicted 2688
4 SASI_Rn02_00358655 predicted 490
5 SASI_Rn02_00358656 predicted 618
6 SASI_Rn02_00358657 predicted 500
7 SASI_Rn02_00358658 predicted 1390
8 SASI_Rn02_00358659 predicted 1578
9 SASI_Rn02_00358660 predicted 1104
10 SASI_Rn02_00358661 predicted 2662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391236 predicted 1870
2 SASI_Rn02_00391237 predicted 745
3 SASI_Rn02_00391238 predicted 2688
4 SASI_Rn02_00391239 predicted 489
5 SASI_Rn02_00391240 predicted 621
6 SASI_Rn02_00391241 predicted 508
7 SASI_Rn02_00391242 predicted 1386
8 SASI_Rn02_00391243 predicted 1582
9 SASI_Rn02_00391244 predicted 1097
10 SASI_Rn02_00391245 predicted 2658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047734 predicted 1709
2 SASI_Mm01_00047735 predicted 395
3 SASI_Mm01_00047736 predicted 1767
4 SASI_Mm02_00316120 predicted 228
5 SASI_Mm01_00047737 predicted 2119
6 SASI_Mm01_00047738 predicted 3488
7 SASI_Mm01_00047739 predicted 506
8 SASI_Mm01_00047740 predicted 1004
9 SASI_Mm01_00047741 predicted 2212
10 SASI_Mm01_00047742 predicted 1023
11 SASI_Mm01_00047743 predicted 1887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009431
VALIDATED
CTR9 MISSION shRNA Bacterial Glycerol Stock
CTR9, Paf1/RNA polymerase II complex component
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009431.1-3988s1c1
Sequence:CCGGGCTGCTATGTACAAACTTGTACTCGAGTACAAGTTTGTACATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-3235s1c1
Sequence:CCGGCCAGGAATAGCAACAGCGATTCTCGAGAATCGCTGTTGCTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-276s1c1
Sequence:CCGGGCGCTGGAATACTACAAGCAACTCGAGTTGCTTGTAGTATTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3694s21c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1673s21c1
Sequence:CCGGCTGTCACCACATCCTACAATTCTCGAGAATTGTAGGATGTGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.2-3694s1c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1943s21c1
Sequence:CCGGAGAAGTTTGAGAGGATATTAACTCGAGTTAATATCCTCTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-218s21c1
Sequence:CCGGGGGATACTGACGAGGTCATTGCTCGAGCAATGACCTCGTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3730s21c1
Sequence:CCGGATGGGTTGGGAGGAGCTTTATCTCGAGATAAAGCTCCTCCCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009431
VALIDATED
CTR9 MISSION shRNA shRNA Plasmid DNA
CTR9, Paf1/RNA polymerase II complex component
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009431.1-3988s1c1
Sequence:CCGGGCTGCTATGTACAAACTTGTACTCGAGTACAAGTTTGTACATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-3235s1c1
Sequence:CCGGCCAGGAATAGCAACAGCGATTCTCGAGAATCGCTGTTGCTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-276s1c1
Sequence:CCGGGCGCTGGAATACTACAAGCAACTCGAGTTGCTTGTAGTATTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3694s21c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1673s21c1
Sequence:CCGGCTGTCACCACATCCTACAATTCTCGAGAATTGTAGGATGTGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.2-3694s1c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1943s21c1
Sequence:CCGGAGAAGTTTGAGAGGATATTAACTCGAGTTAATATCCTCTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-218s21c1
Sequence:CCGGGGGATACTGACGAGGTCATTGCTCGAGCAATGACCTCGTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3730s21c1
Sequence:CCGGATGGGTTGGGAGGAGCTTTATCTCGAGATAAAGCTCCTCCCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009431
VALIDATED
CTR9 MISSION shRNA Lentiviral Transduction Particles
CTR9, Paf1/RNA polymerase II complex component
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009431.1-3988s1c1
Sequence:CCGGGCTGCTATGTACAAACTTGTACTCGAGTACAAGTTTGTACATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-3235s1c1
Sequence:CCGGCCAGGAATAGCAACAGCGATTCTCGAGAATCGCTGTTGCTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.1-276s1c1
Sequence:CCGGGCGCTGGAATACTACAAGCAACTCGAGTTGCTTGTAGTATTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3694s21c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1673s21c1
Sequence:CCGGCTGTCACCACATCCTACAATTCTCGAGAATTGTAGGATGTGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009431.2-3694s1c1
Sequence:CCGGGATGATAGCGACTAGGTTTATCTCGAGATAAACCTAGTCGCTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-1943s21c1
Sequence:CCGGAGAAGTTTGAGAGGATATTAACTCGAGTTAATATCCTCTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-218s21c1
Sequence:CCGGGGGATACTGACGAGGTCATTGCTCGAGCAATGACCTCGTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009431.2-3730s21c1
Sequence:CCGGATGGGTTGGGAGGAGCTTTATCTCGAGATAAAGCTCCTCCCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014633
VALIDATED
CTR9 MISSION shRNA Bacterial Glycerol Stock
CTR9, Paf1/RNA polymerase II complex component
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3884s1c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-1521s1c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-2664s1c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-369s1c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3207s1c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-345s21c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014633.3-3860s21c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-1497s21c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-2640s21c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-3183s21c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014633
VALIDATED
CTR9 MISSION shRNA shRNA Plasmid DNA
CTR9, Paf1/RNA polymerase II complex component
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3884s1c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-1521s1c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-2664s1c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-369s1c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3207s1c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-345s21c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014633.3-3860s21c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-1497s21c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-2640s21c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-3183s21c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014633
VALIDATED
CTR9 MISSION shRNA Lentiviral Transduction Particles
CTR9, Paf1/RNA polymerase II complex component
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3884s1c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-1521s1c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-2664s1c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-369s1c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014633.2-3207s1c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-345s21c1
Sequence:CCGGGCAGCACGTATAGATGGCAATCTCGAGATTGCCATCTATACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014633.3-3860s21c1
Sequence:CCGGCGTGCAAATGAGACTATTCTTCTCGAGAAGAATAGTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-1497s21c1
Sequence:CCGGCCTCCAGAGATTCTCAATAATCTCGAGATTATTGAGAATCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-2640s21c1
Sequence:CCGGGCACGCAAACAAGATGAAGAACTCGAGTTCTTCATCTTGTTTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014633.3-3183s21c1
Sequence:CCGGGCCATAATTTCATCAAGTGATCTCGAGATCACTTGATGAAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks