EMAIL THIS PAGE TO A FRIEND

CTRB1

chymotrypsinogen B1

43 Gene Product Result for
Synonyms: CTRB
UniProtKB ID: P17538
Gene ID:
Human(1504) Summary: The protein encoded by this gene is one of a family of serine proteases that is secreted into the gastrointestinal tract as an inactive precursor, which is activated by proteolytic cleavage with trypsin. [provided by RefSeq, Oct 2011]
Mouse(66473) chymotrypsinogen B1
Rat(24291) chymotrypsinogen B1
naked mole-rat(101719459) chymotrypsinogen B1
sheep(101117443) chymotrypsinogen B1
Zebrafish(322451) chymotrypsinogen B1
cow(504241) chymotrypsinogen B1
domestic cat(101096371) chymotrypsinogen B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
C8946 α-Chymotrypsin from human pancreas lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147551 MISSION® esiRNA esiRNA human CTRB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001906 Rosetta Predictions human pricing
NM_012536 Rosetta Predictions rat pricing
NM_025583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332781 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049836 predicted 392
2 SASI_Rn01_00049837 predicted 393
3 SASI_Rn01_00049838 predicted 294
4 SASI_Rn01_00049839 predicted 344
5 SASI_Rn01_00049840 predicted 377
6 SASI_Rn01_00049842 predicted 325
7 SASI_Rn01_00049843 predicted 297
8 SASI_Rn01_00049844 predicted 420
9 SASI_Rn01_00049845 predicted 530
10 SASI_Rn02_00259612 predicted 399
11 SASI_Rn01_00049841 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084934 predicted 410
2 SASI_Mm01_00084942 predicted 435
3 SASI_Mm02_00328558 predicted 427
4 SASI_Mm01_00084943 predicted 263
5 SASI_Mm02_00328559 predicted 557
6 SASI_Mm02_00328560 predicted 285
7 SASI_Mm02_00328561 predicted 563
8 SASI_Mm01_00084935 predicted 406
9 SASI_Mm01_00084936 predicted 415
10 SASI_Mm01_00084937 predicted 264
11 SASI_Mm01_00084938 predicted 373
12 SASI_Mm01_00084939 predicted 428
13 SASI_Mm01_00084940 predicted 383
14 SASI_Mm01_00084941 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001906
CTRB1 MISSION shRNA Bacterial Glycerol Stock
chymotrypsinogen B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-360s21c1
Sequence:CCGGGCATTCTGACCGTGAACAATGCTCGAGCATTGTTCACGGTCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-327s21c1
Sequence:CCGGAGATCGCCAAGGTCTTCAAGACTCGAGTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-567s21c1
Sequence:CCGGCCAATGCCGAATGCAAGAAGTCTCGAGACTTCTTGCATTCGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-496s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-500s1c1
Sequence:CCGGACCAAGTACAACGCCAACAAGCTCGAGCTTGTTGGCGTTGTACTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-502s1c1
Sequence:CCGGCAAGTACAACGCCAACAAGACCTCGAGGTCTTGTTGGCGTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001906.1-504s1c1
Sequence:CCGGAGTACAACGCCAACAAGACCCCTCGAGGGGTCTTGTTGGCGTTGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-498s1c1
Sequence:CCGGAGACCAAGTACAACGCCAACACTCGAGTGTTGGCGTTGTACTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001906
CTRB1 MISSION shRNA shRNA Plasmid DNA
chymotrypsinogen B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-360s21c1
Sequence:CCGGGCATTCTGACCGTGAACAATGCTCGAGCATTGTTCACGGTCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-327s21c1
Sequence:CCGGAGATCGCCAAGGTCTTCAAGACTCGAGTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-567s21c1
Sequence:CCGGCCAATGCCGAATGCAAGAAGTCTCGAGACTTCTTGCATTCGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-496s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-500s1c1
Sequence:CCGGACCAAGTACAACGCCAACAAGCTCGAGCTTGTTGGCGTTGTACTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-502s1c1
Sequence:CCGGCAAGTACAACGCCAACAAGACCTCGAGGTCTTGTTGGCGTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001906.1-504s1c1
Sequence:CCGGAGTACAACGCCAACAAGACCCCTCGAGGGGTCTTGTTGGCGTTGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-498s1c1
Sequence:CCGGAGACCAAGTACAACGCCAACACTCGAGTGTTGGCGTTGTACTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001906
CTRB1 MISSION shRNA Lentiviral Transduction Particles
chymotrypsinogen B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-360s21c1
Sequence:CCGGGCATTCTGACCGTGAACAATGCTCGAGCATTGTTCACGGTCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-327s21c1
Sequence:CCGGAGATCGCCAAGGTCTTCAAGACTCGAGTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001906.4-567s21c1
Sequence:CCGGCCAATGCCGAATGCAAGAAGTCTCGAGACTTCTTGCATTCGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-496s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-500s1c1
Sequence:CCGGACCAAGTACAACGCCAACAAGCTCGAGCTTGTTGGCGTTGTACTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-502s1c1
Sequence:CCGGCAAGTACAACGCCAACAAGACCTCGAGGTCTTGTTGGCGTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001906.1-504s1c1
Sequence:CCGGAGTACAACGCCAACAAGACCCCTCGAGGGGTCTTGTTGGCGTTGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001906.1-498s1c1
Sequence:CCGGAGACCAAGTACAACGCCAACACTCGAGTGTTGGCGTTGTACTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025583
CTRB1 MISSION shRNA Bacterial Glycerol Stock
chymotrypsinogen B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-510s1c1
Sequence:CCGGGACCAAATACAATGCCCTCAACTCGAGTTGAGGGCATTGTATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-114s1c1
Sequence:CCGGCGGTCTGTCCAGGATCGTCAACTCGAGTTGACGATCCTGGACAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-561s1c1
Sequence:CCGGGCCCATCGTGTCCGAGGCTAACTCGAGTTAGCCTCGGACACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-363s1c1
Sequence:CCGGCAACTCCTTCACCGTGCGTAACTCGAGTTACGCACGGTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-450s1c1
Sequence:CCGGGCCCACTGTTGACGATGACTTCTCGAGAAGTCATCGTCAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025583
CTRB1 MISSION shRNA shRNA Plasmid DNA
chymotrypsinogen B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-510s1c1
Sequence:CCGGGACCAAATACAATGCCCTCAACTCGAGTTGAGGGCATTGTATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-114s1c1
Sequence:CCGGCGGTCTGTCCAGGATCGTCAACTCGAGTTGACGATCCTGGACAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-561s1c1
Sequence:CCGGGCCCATCGTGTCCGAGGCTAACTCGAGTTAGCCTCGGACACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-363s1c1
Sequence:CCGGCAACTCCTTCACCGTGCGTAACTCGAGTTACGCACGGTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-450s1c1
Sequence:CCGGGCCCACTGTTGACGATGACTTCTCGAGAAGTCATCGTCAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025583
CTRB1 MISSION shRNA Lentiviral Transduction Particles
chymotrypsinogen B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-510s1c1
Sequence:CCGGGACCAAATACAATGCCCTCAACTCGAGTTGAGGGCATTGTATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-114s1c1
Sequence:CCGGCGGTCTGTCCAGGATCGTCAACTCGAGTTGACGATCCTGGACAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-561s1c1
Sequence:CCGGGCCCATCGTGTCCGAGGCTAACTCGAGTTAGCCTCGGACACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-363s1c1
Sequence:CCGGCAACTCCTTCACCGTGCGTAACTCGAGTTACGCACGGTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025583.1-450s1c1
Sequence:CCGGGCCCACTGTTGACGATGACTTCTCGAGAAGTCATCGTCAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks