EMAIL THIS PAGE TO A FRIEND

CTRB2

chymotrypsinogen B2

9 Gene Product Result for
UniProtKB ID: Q6GPI1, A8K707
Gene ID:
cow(529639) chymotrypsinogen B2
dog(479650) chymotrypsinogen B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025200 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114191 MISSION® esiRNA esiRNA human CTRB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025200 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135356 predicted 840
2 SASI_Hs02_00307404 predicted 854
3 SASI_Hs02_00307405 predicted 857
4 SASI_Hs02_00307406 predicted 846
5 SASI_Hs01_00135357 predicted 839
6 SASI_Hs01_00135358 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025200
VALIDATED
CTRB2 MISSION shRNA Bacterial Glycerol Stock
chymotrypsinogen B2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025200.1-527s1c1
Sequence:CCGGCCAAGTACAACGCCAACAAGACTCGAGTCTTGTTGGCGTTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-348s1c1
Sequence:CCGGGATCGCCAAGGTCTTCAAGAACTCGAGTTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-330s1c1
Sequence:CCGGGAACATCCAGGTCCTGAAGATCTCGAGATCTTCAGGACCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-393s1c1
Sequence:CCGGGAACAATGACATCACCCTGCTCTCGAGAGCAGGGTGATGTCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-345s1c1
Sequence:CCGGGAAGATCGCCAAGGTCTTCAACTCGAGTTGAAGACCTTGGCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-396s1c1
Sequence:CCGGCAATGACATCACCCTGCTGAACTCGAGTTCAGCAGGGTGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-522s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-372s1c1
Sequence:CCGGCAAGTTCAGCATTCTGACCGTCTCGAGACGGTCAGAATGCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-390s1c1
Sequence:CCGGCGTGAACAATGACATCACCCTCTCGAGAGGGTGATGTCATTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025200
VALIDATED
CTRB2 MISSION shRNA shRNA Plasmid DNA
chymotrypsinogen B2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025200.1-527s1c1
Sequence:CCGGCCAAGTACAACGCCAACAAGACTCGAGTCTTGTTGGCGTTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-348s1c1
Sequence:CCGGGATCGCCAAGGTCTTCAAGAACTCGAGTTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-330s1c1
Sequence:CCGGGAACATCCAGGTCCTGAAGATCTCGAGATCTTCAGGACCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-393s1c1
Sequence:CCGGGAACAATGACATCACCCTGCTCTCGAGAGCAGGGTGATGTCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-345s1c1
Sequence:CCGGGAAGATCGCCAAGGTCTTCAACTCGAGTTGAAGACCTTGGCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-396s1c1
Sequence:CCGGCAATGACATCACCCTGCTGAACTCGAGTTCAGCAGGGTGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-522s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-372s1c1
Sequence:CCGGCAAGTTCAGCATTCTGACCGTCTCGAGACGGTCAGAATGCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-390s1c1
Sequence:CCGGCGTGAACAATGACATCACCCTCTCGAGAGGGTGATGTCATTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025200
VALIDATED
CTRB2 MISSION shRNA Lentiviral Transduction Particles
chymotrypsinogen B2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025200.1-527s1c1
Sequence:CCGGCCAAGTACAACGCCAACAAGACTCGAGTCTTGTTGGCGTTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-348s1c1
Sequence:CCGGGATCGCCAAGGTCTTCAAGAACTCGAGTTCTTGAAGACCTTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-330s1c1
Sequence:CCGGGAACATCCAGGTCCTGAAGATCTCGAGATCTTCAGGACCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-393s1c1
Sequence:CCGGGAACAATGACATCACCCTGCTCTCGAGAGCAGGGTGATGTCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-345s1c1
Sequence:CCGGGAAGATCGCCAAGGTCTTCAACTCGAGTTGAAGACCTTGGCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-396s1c1
Sequence:CCGGCAATGACATCACCCTGCTGAACTCGAGTTCAGCAGGGTGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-522s1c1
Sequence:CCGGCAAGACCAAGTACAACGCCAACTCGAGTTGGCGTTGTACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025200.1-372s1c1
Sequence:CCGGCAAGTTCAGCATTCTGACCGTCTCGAGACGGTCAGAATGCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025200.1-390s1c1
Sequence:CCGGCGTGAACAATGACATCACCCTCTCGAGAGGGTGATGTCATTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks