EMAIL THIS PAGE TO A FRIEND

CTRC

chymotrypsin C (caldecrin)

58 Gene Product Result for
Synonyms: CLCR ELA4
UniProtKB ID: Q99895, A8K082, O00765, Q9NUH5
Gene ID:
Human(11330) Summary: This gene encodes a member of the peptidase S1 family. The encoded protein is a serum calcium-decreasing factor that has chymotrypsin-like protease activity. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(76701) chymotrypsin C (caldecrin)
Rat(362653) chymotrypsin C (caldecrin)
chicken(430670) chymotrypsin C (caldecrin)
dog(478220) chymotrypsin C (caldecrin)
domestic cat(101081235) chymotrypsin C (caldecrin)
cow(514047) chymotrypsin C (caldecrin)
sheep(101111471) chymotrypsin C (caldecrin)
domestic guinea pig(100715802) chymotrypsin C (caldecrin)
naked mole-rat(101703734) chymotrypsin C (caldecrin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007272 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007272 Rosetta Predictions human pricing
NM_001077649 Rosetta Predictions rat pricing
XM_342970 Rosetta Predictions rat pricing
NM_001033875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152693 predicted 197
2 SASI_Hs01_00152694 predicted 378
3 SASI_Hs01_00152696 predicted 336
4 SASI_Hs01_00152697 predicted 196
5 SASI_Hs01_00152698 predicted 305
6 SASI_Hs01_00152699 predicted 675
7 SASI_Hs01_00152700 predicted 201
8 SASI_Hs01_00152701 predicted 262
9 SASI_Hs01_00152702 predicted 369
10 SASI_Hs02_00343322 predicted 292
11 SASI_Hs01_00152695 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207722 predicted 359
2 SASI_Rn02_00207723 predicted 500
3 SASI_Rn02_00207724 predicted 464
4 SASI_Rn02_00207725 predicted 324
5 SASI_Rn02_00207726 predicted 647
6 SASI_Rn02_00207727 predicted 362
7 SASI_Rn02_00207728 predicted 268
8 SASI_Rn02_00207729 predicted 308
9 SASI_Rn02_00207730 predicted 299
10 SASI_Rn02_00207731 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151140 predicted 359
2 SASI_Rn01_00151141 predicted 503
3 SASI_Rn01_00151142 predicted 457
4 SASI_Rn01_00151143 predicted 654
5 SASI_Rn01_00151144 predicted 390
6 SASI_Rn01_00151145 predicted 663
7 SASI_Rn01_00151146 predicted 281
8 SASI_Rn01_00151147 predicted 370
9 SASI_Rn01_00151148 predicted 267
10 SASI_Rn01_00151149 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289019 predicted 206
2 SASI_Mm01_00168071 predicted 703
3 SASI_Mm01_00168072 predicted 541
4 SASI_Mm01_00168073 predicted 427
5 SASI_Mm01_00168074 predicted 446
6 SASI_Mm01_00168075 predicted 725
7 SASI_Mm01_00168076 predicted 407
8 SASI_Mm01_00168077 predicted 243
9 SASI_Mm01_00168079 predicted 587
10 SASI_Mm01_00168080 predicted 500
11 SASI_Mm01_00168078 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355529
CTRC MISSION shRNA Bacterial Glycerol Stock
chymotrypsin C (caldecrin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-309s1c1
Sequence:CCGGCCACTGCATCAACACAAACTTCTCGAGAAGTTTGTGTTGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-654s1c1
Sequence:CCGGGTTGGACTGGTGGTTCATCAACTCGAGTTGATGAACCACCAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-791s1c1
Sequence:CCGGTCGTGAGCTTTGGTTCCAGTACTCGAGTACTGGAACCAAAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-400s1c1
Sequence:CCGGGTGGATACCATCTACGTCCATCTCGAGATGGACGTAGATGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-84s1c1
Sequence:CCGGCCTGAACCATGTTGGGAATTACTCGAGTAATTCCCAACATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355529
CTRC MISSION shRNA shRNA Plasmid DNA
chymotrypsin C (caldecrin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-309s1c1
Sequence:CCGGCCACTGCATCAACACAAACTTCTCGAGAAGTTTGTGTTGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-654s1c1
Sequence:CCGGGTTGGACTGGTGGTTCATCAACTCGAGTTGATGAACCACCAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-791s1c1
Sequence:CCGGTCGTGAGCTTTGGTTCCAGTACTCGAGTACTGGAACCAAAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-400s1c1
Sequence:CCGGGTGGATACCATCTACGTCCATCTCGAGATGGACGTAGATGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-84s1c1
Sequence:CCGGCCTGAACCATGTTGGGAATTACTCGAGTAATTCCCAACATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355529
CTRC MISSION shRNA Lentiviral Transduction Particles
chymotrypsin C (caldecrin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-309s1c1
Sequence:CCGGCCACTGCATCAACACAAACTTCTCGAGAAGTTTGTGTTGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-654s1c1
Sequence:CCGGGTTGGACTGGTGGTTCATCAACTCGAGTTGATGAACCACCAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-791s1c1
Sequence:CCGGTCGTGAGCTTTGGTTCCAGTACTCGAGTACTGGAACCAAAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-400s1c1
Sequence:CCGGGTGGATACCATCTACGTCCATCTCGAGATGGACGTAGATGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355529.3-84s1c1
Sequence:CCGGCCTGAACCATGTTGGGAATTACTCGAGTAATTCCCAACATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007272
CTRC MISSION shRNA Bacterial Glycerol Stock
chymotrypsin C (caldecrin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-354s1c1
Sequence:CCGGGCGCAATGATATTGCCCTCATCTCGAGATGAGGGCAATATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-691s1c1
Sequence:CCGGGTGTTTGGCATCGTCAGCTTTCTCGAGAAAGCTGACGATGCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-321s1c1
Sequence:CCGGCCACGTCCACAAGAGATGGAACTCGAGTTCCATCTCTTGTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-735s1c1
Sequence:CCGGCCGCAAGAAGCCGGTAGTCTACTCGAGTAGACTACCGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-183s1c1
Sequence:CCGGGACTTTGATTGCTAGCAACTTCTCGAGAAGTTGCTAGCAATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-155s21c1
Sequence:CCGGGATCTCCCTCCAGTACCTCAACTCGAGTTGAGGTACTGGAGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-307s21c1
Sequence:CCGGACGAAGAAGGATCCCTGTTTGCTCGAGCAAACAGGGATCCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-682s21c1
Sequence:CCGGTGAACTGCCAGTTGGAGAACGCTCGAGCGTTCTCCAACTGGCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007272
CTRC MISSION shRNA shRNA Plasmid DNA
chymotrypsin C (caldecrin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-354s1c1
Sequence:CCGGGCGCAATGATATTGCCCTCATCTCGAGATGAGGGCAATATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-691s1c1
Sequence:CCGGGTGTTTGGCATCGTCAGCTTTCTCGAGAAAGCTGACGATGCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-321s1c1
Sequence:CCGGCCACGTCCACAAGAGATGGAACTCGAGTTCCATCTCTTGTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-735s1c1
Sequence:CCGGCCGCAAGAAGCCGGTAGTCTACTCGAGTAGACTACCGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-183s1c1
Sequence:CCGGGACTTTGATTGCTAGCAACTTCTCGAGAAGTTGCTAGCAATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-155s21c1
Sequence:CCGGGATCTCCCTCCAGTACCTCAACTCGAGTTGAGGTACTGGAGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-307s21c1
Sequence:CCGGACGAAGAAGGATCCCTGTTTGCTCGAGCAAACAGGGATCCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-682s21c1
Sequence:CCGGTGAACTGCCAGTTGGAGAACGCTCGAGCGTTCTCCAACTGGCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007272
CTRC MISSION shRNA Lentiviral Transduction Particles
chymotrypsin C (caldecrin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-354s1c1
Sequence:CCGGGCGCAATGATATTGCCCTCATCTCGAGATGAGGGCAATATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-691s1c1
Sequence:CCGGGTGTTTGGCATCGTCAGCTTTCTCGAGAAAGCTGACGATGCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-321s1c1
Sequence:CCGGCCACGTCCACAAGAGATGGAACTCGAGTTCCATCTCTTGTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-735s1c1
Sequence:CCGGCCGCAAGAAGCCGGTAGTCTACTCGAGTAGACTACCGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007272.1-183s1c1
Sequence:CCGGGACTTTGATTGCTAGCAACTTCTCGAGAAGTTGCTAGCAATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-155s21c1
Sequence:CCGGGATCTCCCTCCAGTACCTCAACTCGAGTTGAGGTACTGGAGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-307s21c1
Sequence:CCGGACGAAGAAGGATCCCTGTTTGCTCGAGCAAACAGGGATCCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007272.2-682s21c1
Sequence:CCGGTGAACTGCCAGTTGGAGAACGCTCGAGCGTTCTCCAACTGGCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks