EMAIL THIS PAGE TO A FRIEND

CTRL

chymotrypsin-like

63 Gene Product Result for
Synonyms: CTRL1
UniProtKB ID: P40313
Gene ID:
Mouse(109660) chymotrypsin-like
Rat(117184) chymotrypsin-like
Zebrafish(447843) chymotrypsin-like
chicken(427531) chymotrypsin-like
domestic cat(101091067) chymotrypsin-like
dog(611100) chymotrypsin-like
sheep(101110356) chymotrypsin-like
naked mole-rat(101701689) chymotrypsin-like
domestic guinea pig(100727962) chymotrypsin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011191 MISSION® esiRNA esiRNA targeting mouse Ctrl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001907 Rosetta Predictions human pricing
NM_054009 Rosetta Predictions rat pricing
NM_023182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035516 predicted 264
2 SASI_Hs01_00035517 predicted 583
3 SASI_Hs01_00035518 predicted 297
4 SASI_Hs01_00035519 predicted 870
5 SASI_Hs01_00035520 predicted 425
6 SASI_Hs01_00035522 predicted 556
7 SASI_Hs01_00035523 predicted 349
8 SASI_Hs01_00035524 predicted 683
9 SASI_Hs01_00035525 predicted 309
10 SASI_Hs02_00332782 predicted 392
11 SASI_Hs01_00035521 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039447 predicted 548
2 SASI_Rn01_00039448 predicted 362
3 SASI_Rn01_00039449 predicted 290
4 SASI_Rn02_00267016 predicted 395
5 SASI_Rn01_00039450 predicted 292
6 SASI_Rn01_00039451 predicted 484
7 SASI_Rn01_00039452 predicted 263
8 SASI_Rn01_00039453 predicted 479
9 SASI_Rn01_00039455 predicted 264
10 SASI_Rn01_00039456 predicted 546
11 SASI_Rn01_00039454 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042890 predicted 200
2 SASI_Mm01_00042884 predicted 607
3 SASI_Mm01_00042886 predicted 446
4 SASI_Mm01_00042887 predicted 606
5 SASI_Mm01_00042888 predicted 576
6 SASI_Mm01_00042889 predicted 297
7 SASI_Mm01_00042891 predicted 359
8 SASI_Mm01_00042892 predicted 424
9 SASI_Mm01_00042893 predicted 506
10 SASI_Mm02_00326906 predicted 291
11 SASI_Mm01_00042885 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001907
CTRL MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-561s21c1
Sequence:CCGGTGAATCAGTGCCGGCAGTACTCTCGAGAGTACTGCCGGCACTGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-590s21c1
Sequence:CCGGAGTATCACTGACTCCATGATCCTCGAGGATCATGGAGTCAGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-756s1c1
Sequence:CCGGGAGTTAGCAAGTTCAGCACCTCTCGAGAGGTGCTGAACTTGCTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-690s1c1
Sequence:CCGGTGCTTATTGGTATTGTCTCCTCTCGAGAGGAGACAATACCAATAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-331s1c1
Sequence:CCGGCATTACACACCCTAGCTGGAACTCGAGTTCCAGCTAGGGTGTGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-402s1c1
Sequence:CCGGCCCAGTACACAACACGCATCTCTCGAGAGATGCGTGTTGTGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001907.x-823s1c1
Sequence:CCGGCCCAGCTCAACCCATTAAAGACTCGAGTCTTTAATGGGTTGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001907
CTRL MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-561s21c1
Sequence:CCGGTGAATCAGTGCCGGCAGTACTCTCGAGAGTACTGCCGGCACTGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-590s21c1
Sequence:CCGGAGTATCACTGACTCCATGATCCTCGAGGATCATGGAGTCAGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-756s1c1
Sequence:CCGGGAGTTAGCAAGTTCAGCACCTCTCGAGAGGTGCTGAACTTGCTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-690s1c1
Sequence:CCGGTGCTTATTGGTATTGTCTCCTCTCGAGAGGAGACAATACCAATAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-331s1c1
Sequence:CCGGCATTACACACCCTAGCTGGAACTCGAGTTCCAGCTAGGGTGTGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-402s1c1
Sequence:CCGGCCCAGTACACAACACGCATCTCTCGAGAGATGCGTGTTGTGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001907.x-823s1c1
Sequence:CCGGCCCAGCTCAACCCATTAAAGACTCGAGTCTTTAATGGGTTGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001907
CTRL MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-561s21c1
Sequence:CCGGTGAATCAGTGCCGGCAGTACTCTCGAGAGTACTGCCGGCACTGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001907.1-590s21c1
Sequence:CCGGAGTATCACTGACTCCATGATCCTCGAGGATCATGGAGTCAGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-756s1c1
Sequence:CCGGGAGTTAGCAAGTTCAGCACCTCTCGAGAGGTGCTGAACTTGCTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-690s1c1
Sequence:CCGGTGCTTATTGGTATTGTCTCCTCTCGAGAGGAGACAATACCAATAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-331s1c1
Sequence:CCGGCATTACACACCCTAGCTGGAACTCGAGTTCCAGCTAGGGTGTGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001907.x-402s1c1
Sequence:CCGGCCCAGTACACAACACGCATCTCTCGAGAGATGCGTGTTGTGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001907.x-823s1c1
Sequence:CCGGCCCAGCTCAACCCATTAAAGACTCGAGTCTTTAATGGGTTGAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023182
CTRL MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-613s1c1
Sequence:CCGGGCATTACCGATGCCATGATATCTCGAGATATCATGGCATCGGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-292s1c1
Sequence:CCGGTGGGAGAATATGACCGATCTTCTCGAGAAGATCGGTCATATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-119s1c1
Sequence:CCGGCTACAATCAGAGAATTGTCAACTCGAGTTGACAATTCTCTGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-111s1c1
Sequence:CCGGGCACTGAGCTACAATCAGAGACTCGAGTCTCTGATTGTAGCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-371s1c1
Sequence:CCGGGAACGCCAACACCATGAACAACTCGAGTTGTTCATGGTGTTGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023182
CTRL MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-613s1c1
Sequence:CCGGGCATTACCGATGCCATGATATCTCGAGATATCATGGCATCGGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-292s1c1
Sequence:CCGGTGGGAGAATATGACCGATCTTCTCGAGAAGATCGGTCATATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-119s1c1
Sequence:CCGGCTACAATCAGAGAATTGTCAACTCGAGTTGACAATTCTCTGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-111s1c1
Sequence:CCGGGCACTGAGCTACAATCAGAGACTCGAGTCTCTGATTGTAGCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-371s1c1
Sequence:CCGGGAACGCCAACACCATGAACAACTCGAGTTGTTCATGGTGTTGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023182
CTRL MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-613s1c1
Sequence:CCGGGCATTACCGATGCCATGATATCTCGAGATATCATGGCATCGGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-292s1c1
Sequence:CCGGTGGGAGAATATGACCGATCTTCTCGAGAAGATCGGTCATATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-119s1c1
Sequence:CCGGCTACAATCAGAGAATTGTCAACTCGAGTTGACAATTCTCTGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-111s1c1
Sequence:CCGGGCACTGAGCTACAATCAGAGACTCGAGTCTCTGATTGTAGCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023182.1-371s1c1
Sequence:CCGGGAACGCCAACACCATGAACAACTCGAGTTGTTCATGGTGTTGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks