EMAIL THIS PAGE TO A FRIEND

CTSA

cathepsin A

84 Gene Product Result for
Synonyms: GLB2 GSL NGBE PPCA PPGB
Gene ID:
Human(5476) Summary: This gene encodes a glycoprotein which associates with lysosomal enzymes beta-galactosidase and neuraminidase to form a complex of high molecular weight multimers. The formation of this complex provides a protective role for stability and activity. Deficiencies in this gene are linked to multiple forms of galactosialidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19025) cathepsin A
Rat(296370) cathepsin A
sheep(101113615) cathepsin A
Zebrafish(321818) cathepsin A
cow(518169) cathepsin A
Horse(100071127) cathepsin A
dog(611146) cathepsin A
chicken(428163) cathepsin A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000308 siRNAs that have been validated in the lab human pricing
NM_001127695 Rosetta Predictions human pricing
NM_001011959 Rosetta Predictions rat pricing
XM_575288 Rosetta Predictions rat pricing
NM_001038492 Rosetta Predictions mouse pricing
NM_008906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000308 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021696 validated 1514
1 SASI_Hs01_00021695 validated 1186
1 SASI_Hs01_00021694 validated 1241
2 SASI_Hs02_00302301 predicted 1731
3 SASI_Hs01_00021698 predicted 1308
4 SASI_Hs01_00021699 predicted 1616
5 SASI_Hs02_00302302 predicted 1347
6 SASI_Hs01_00021700 predicted 1292
7 SASI_Hs01_00021701 predicted 1512
8 SASI_Hs01_00021702 predicted 1548
9 SASI_Hs01_00021703 predicted 1494
10 SASI_Hs01_00021697 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330154 predicted 1279
2 SASI_Hs02_00330155 predicted 1555
3 SASI_Hs02_00330156 predicted 1775
4 SASI_Hs02_00330157 predicted 1357
5 SASI_Hs02_00330158 predicted 1661
6 SASI_Hs02_00330159 predicted 1399
7 SASI_Hs02_00330160 predicted 1343
8 SASI_Hs02_00330161 predicted 1558
9 SASI_Hs02_00330162 predicted 1599
10 SASI_Hs02_00330163 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078689 predicted 1613
2 SASI_Rn02_00199976 predicted 1518
3 SASI_Rn01_00078692 predicted 1596
4 SASI_Rn01_00078693 predicted 904
5 SASI_Rn01_00078694 predicted 611
6 SASI_Rn02_00199977 predicted 596
7 SASI_Rn01_00078695 predicted 1174
8 SASI_Rn01_00078696 predicted 946
9 SASI_Rn01_00078697 predicted 872
10 SASI_Rn01_00078698 predicted 873
11 SASI_Rn01_00078690 predicted 511
12 SASI_Rn01_00078691 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140746 predicted 404
2 SASI_Rn01_00140747 predicted 927
3 SASI_Rn01_00140748 predicted 796
4 SASI_Rn01_00140749 predicted 515
5 SASI_Rn01_00140750 predicted 1074
6 SASI_Rn01_00140751 predicted 853
7 SASI_Rn01_00140752 predicted 771
8 SASI_Rn01_00140753 predicted 405
9 SASI_Rn01_00140754 predicted 504
10 SASI_Rn01_00140755 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077061 predicted 1115
2 SASI_Mm01_00077062 predicted 918
3 SASI_Mm01_00077063 predicted 1387
4 SASI_Mm01_00077064 predicted 1102
5 SASI_Mm01_00077065 predicted 1723
6 SASI_Mm01_00077066 predicted 1032
7 SASI_Mm01_00077067 predicted 1128
8 SASI_Mm01_00077068 predicted 1188
9 SASI_Mm01_00077069 predicted 936
10 SASI_Mm01_00077070 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172719 predicted 1248
2 SASI_Mm01_00172720 predicted 1047
3 SASI_Mm01_00172721 predicted 1509
4 SASI_Mm01_00172722 predicted 1236
5 SASI_Mm01_00172723 predicted 1852
6 SASI_Mm01_00172724 predicted 1160
7 SASI_Mm01_00172725 predicted 1259
8 SASI_Mm01_00172726 predicted 1308
9 SASI_Mm01_00172727 predicted 1061
10 SASI_Mm01_00172728 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008906
VALIDATED
CTSA MISSION shRNA Bacterial Glycerol Stock
cathepsin A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-119s1c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1035s1c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-843s1c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-753s1c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1149s1c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-525s21c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1441s21c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1159s21c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1555s21c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1249s21c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008906
VALIDATED
CTSA MISSION shRNA shRNA Plasmid DNA
cathepsin A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-119s1c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1035s1c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-843s1c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-753s1c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1149s1c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-525s21c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1441s21c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1159s21c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1555s21c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1249s21c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008906
VALIDATED
CTSA MISSION shRNA Lentiviral Transduction Particles
cathepsin A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-119s1c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1035s1c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-843s1c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-753s1c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008906.2-1149s1c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-525s21c1
Sequence:CCGGCGGACCAGGATGAAATCGATTCTCGAGAATCGATTTCATCCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1441s21c1
Sequence:CCGGCCCTTCCAACTACCTCAACAACTCGAGTTGTTGAGGTAGTTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1159s21c1
Sequence:CCGGCGCTCAGAACAAGTGTAACTTCTCGAGAAGTTACACTTGTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1555s21c1
Sequence:CCGGCCAAAGCATGAACTCCCAGTACTCGAGTACTGGGAGTTCATGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008906.3-1249s21c1
Sequence:CCGGCCTCAACATCTACAATCTCTACTCGAGTAGAGATTGTAGATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000308
VALIDATED
CTSA MISSION shRNA Bacterial Glycerol Stock
cathepsin A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1502s1c1
Sequence:CCGGGCTAGGAGAGTCCTCTTCTAACTCGAGTTAGAAGAGGACTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1129s1c1
Sequence:CCGGCGAAGCATGAACTCCCAGTATCTCGAGATACTGGGAGTTCATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-346s1c1
Sequence:CCGGCCCTATTCTTGGAATCTGATTCTCGAGAATCAGATTCCAAGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1155s1c1
Sequence:CCGGGCTGCTTAGCTCACAGAAATACTCGAGTATTTCTGTGAGCTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-499s1c1
Sequence:CCGGCCGGAGTACAAGAACAACAAACTCGAGTTTGTTGTTCTTGTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000308.2-2056s21c1
Sequence:CCGGGCACTTTATTCCCGCAGCAGTCTCGAGACTGCTGCGGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-1509s21c1
Sequence:CCGGATGTGCAACTTTCTGGTAAACCTCGAGGTTTACCAGAAAGTTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-869s21c1
Sequence:CCGGTGAGGTCGCCCAGAGCAATTTCTCGAGAAATTGCTCTGGGCGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000308
VALIDATED
CTSA MISSION shRNA shRNA Plasmid DNA
cathepsin A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1502s1c1
Sequence:CCGGGCTAGGAGAGTCCTCTTCTAACTCGAGTTAGAAGAGGACTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1129s1c1
Sequence:CCGGCGAAGCATGAACTCCCAGTATCTCGAGATACTGGGAGTTCATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-346s1c1
Sequence:CCGGCCCTATTCTTGGAATCTGATTCTCGAGAATCAGATTCCAAGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1155s1c1
Sequence:CCGGGCTGCTTAGCTCACAGAAATACTCGAGTATTTCTGTGAGCTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-499s1c1
Sequence:CCGGCCGGAGTACAAGAACAACAAACTCGAGTTTGTTGTTCTTGTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000308.2-2056s21c1
Sequence:CCGGGCACTTTATTCCCGCAGCAGTCTCGAGACTGCTGCGGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-1509s21c1
Sequence:CCGGATGTGCAACTTTCTGGTAAACCTCGAGGTTTACCAGAAAGTTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-869s21c1
Sequence:CCGGTGAGGTCGCCCAGAGCAATTTCTCGAGAAATTGCTCTGGGCGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000308
VALIDATED
CTSA MISSION shRNA Lentiviral Transduction Particles
cathepsin A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1502s1c1
Sequence:CCGGGCTAGGAGAGTCCTCTTCTAACTCGAGTTAGAAGAGGACTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1129s1c1
Sequence:CCGGCGAAGCATGAACTCCCAGTATCTCGAGATACTGGGAGTTCATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-346s1c1
Sequence:CCGGCCCTATTCTTGGAATCTGATTCTCGAGAATCAGATTCCAAGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-1155s1c1
Sequence:CCGGGCTGCTTAGCTCACAGAAATACTCGAGTATTTCTGTGAGCTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000308.1-499s1c1
Sequence:CCGGCCGGAGTACAAGAACAACAAACTCGAGTTTGTTGTTCTTGTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000308.2-2056s21c1
Sequence:CCGGGCACTTTATTCCCGCAGCAGTCTCGAGACTGCTGCGGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-1509s21c1
Sequence:CCGGATGTGCAACTTTCTGGTAAACCTCGAGGTTTACCAGAAAGTTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000308.2-869s21c1
Sequence:CCGGTGAGGTCGCCCAGAGCAATTTCTCGAGAAATTGCTCTGGGCGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks