EMAIL THIS PAGE TO A FRIEND

CTSB

cathepsin B

138 Gene Product Result for
Synonyms: APPS CPSB
UniProtKB ID: P07858, B3KQR5, B3KRR5, Q503A6, Q96D87
Gene ID:
Human(1508) Summary: The protein encoded by this gene is a lysosomal cysteine proteinase composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor. It is also known as amyloid precursor protein secretase and is involved in the proteolytic processing of amyloid precursor protein (APP). Incomplete proteolytic processing of APP has been suggested to be a causative factor in Alzheimer disease, the most common cause of dementia. Overexpression of the encoded protein, which is a member of the peptidase C1 family, has been associated with esophageal adenocarcinoma and other tumors. At least five transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13030) cathepsin B
Rat(64529) cathepsin B
chicken(396329) cathepsin B
dog(486077) cathepsin B
cow(281105) cathepsin B
Horse(100060963) cathepsin B
sheep(780470) cathepsin B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0727 Human CTSB / Cathepsin B ELISA Kit human pricing

Kits

Product # Description Species Add to Cart
 
MAK200 Cathepsin B Inhibitor Screening Kit Sufficient for 100 Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001908 Rosetta Predictions human pricing
NM_147780 Rosetta Predictions human pricing
NM_147781 Rosetta Predictions human pricing
NM_147782 Rosetta Predictions human pricing
NM_147783 Rosetta Predictions human pricing
NM_022597 Rosetta Predictions rat pricing
XM_579460 Rosetta Predictions rat pricing
NM_007798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108033 predicted 1561
2 SASI_Hs01_00108034 predicted 659
3 SASI_Hs01_00108035 predicted 1652
4 SASI_Hs01_00108036 predicted 678
5 SASI_Hs01_00108037 predicted 937
6 SASI_Hs01_00108038 predicted 834
7 SASI_Hs01_00108039 predicted 812
8 SASI_Hs01_00108040 predicted 567
9 SASI_Hs01_00108041 predicted 1259
10 SASI_Hs01_00108042 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029900 predicted 1726
2 SASI_Hs01_00029901 predicted 816
3 SASI_Hs01_00029902 predicted 1816
4 SASI_Hs01_00029903 predicted 847
5 SASI_Hs01_00029904 predicted 1102
6 SASI_Hs01_00029905 predicted 991
7 SASI_Hs01_00029906 predicted 970
8 SASI_Hs01_00029907 predicted 729
9 SASI_Hs01_00029908 predicted 1423
10 SASI_Hs01_00029909 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020890 predicted 1682
2 SASI_Hs01_00020891 predicted 772
3 SASI_Hs01_00020892 predicted 1771
4 SASI_Hs01_00020893 predicted 798
5 SASI_Hs01_00020894 predicted 1059
6 SASI_Hs01_00020895 predicted 949
7 SASI_Hs01_00020896 predicted 925
8 SASI_Hs01_00020897 predicted 690
9 SASI_Hs01_00020898 predicted 1383
10 SASI_Hs01_00020899 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243185 predicted 1657
2 SASI_Hs01_00243186 predicted 747
3 SASI_Hs01_00243187 predicted 1739
4 SASI_Hs01_00243188 predicted 767
5 SASI_Hs01_00243189 predicted 1023
6 SASI_Hs01_00243190 predicted 919
7 SASI_Hs01_00243191 predicted 893
8 SASI_Hs01_00243192 predicted 658
9 SASI_Hs01_00243193 predicted 1353
10 SASI_Hs01_00243194 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104577 predicted 1635
2 SASI_Hs01_00104578 predicted 731
3 SASI_Hs01_00104579 predicted 1722
4 SASI_Hs01_00104580 predicted 755
5 SASI_Hs01_00104581 predicted 1015
6 SASI_Hs01_00104582 predicted 908
7 SASI_Hs01_00104583 predicted 886
8 SASI_Hs01_00104584 predicted 641
9 SASI_Hs01_00104585 predicted 1332
10 SASI_Hs01_00104586 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101725 predicted 684
2 SASI_Rn01_00101726 predicted 1160
3 SASI_Rn02_00263345 predicted 1227
4 SASI_Rn01_00101727 predicted 1144
5 SASI_Rn01_00101728 predicted 780
6 SASI_Rn01_00101729 predicted 376
7 SASI_Rn01_00101730 predicted 600
8 SASI_Rn01_00101731 predicted 266
9 SASI_Rn02_00263346 predicted 499
10 SASI_Rn01_00101732 predicted 796
11 SASI_Rn01_00101733 predicted 800
12 SASI_Rn01_00101734 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187200 predicted 622
2 SASI_Rn01_00187201 predicted 1088
3 SASI_Rn01_00187202 predicted 1160
4 SASI_Rn01_00187203 predicted 1072
5 SASI_Rn01_00187204 predicted 706
6 SASI_Rn01_00187205 predicted 303
7 SASI_Rn01_00187206 predicted 541
8 SASI_Rn01_00187207 predicted 202
9 SASI_Rn01_00187208 predicted 727
10 SASI_Rn01_00187209 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187442 predicted 808
2 SASI_Mm02_00312487 predicted 370
3 SASI_Mm01_00187443 predicted 532
4 SASI_Mm01_00187445 predicted 258
5 SASI_Mm01_00187447 predicted 618
6 SASI_Mm01_00187448 predicted 402
7 SASI_Mm02_00312488 predicted 794
8 SASI_Mm01_00187449 predicted 785
9 SASI_Mm01_00187450 predicted 721
10 SASI_Mm02_00312489 predicted 205
11 SASI_Mm01_00187444 predicted 841
12 SASI_Mm01_00187446 predicted 1146
13 SASI_Mm01_00187451 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001908
VALIDATED
CTSB MISSION shRNA Bacterial Glycerol Stock
cathepsin B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001908.3-1251s21c1
Sequence:CCGGTTCACGTAAGATACAAGTTTCCTCGAGGAAACTTGTATCTTACGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001908.3-931s21c1
Sequence:CCGGTCGGACTTCCTGCTCTACAAGCTCGAGCTTGTAGAGCAGGAAGTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-952s1c1
Sequence:CCGGCCAACACGTCACCGGAGAGATCTCGAGATCTCTCCGGTGACGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001908.x-1648s1c1
Sequence:CCGGATCTATCGAGTTTGCAATGTCCTCGAGGACATTGCAAACTCGATAGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-238s1c1
Sequence:CCGGGCTGGTCAACTATGTCAACAACTCGAGTTGTTGACATAGTTGACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-358s1c1
Sequence:CCGGCCAGAGAGTTATGTTTACCGACTCGAGTCGGTAAACATAACTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-815s1c1
Sequence:CCGGGACAAGCACTACGGATACAATCTCGAGATTGTATCCGTAGTGCTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001908
VALIDATED
CTSB MISSION shRNA shRNA Plasmid DNA
cathepsin B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001908.3-1251s21c1
Sequence:CCGGTTCACGTAAGATACAAGTTTCCTCGAGGAAACTTGTATCTTACGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001908.3-931s21c1
Sequence:CCGGTCGGACTTCCTGCTCTACAAGCTCGAGCTTGTAGAGCAGGAAGTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-952s1c1
Sequence:CCGGCCAACACGTCACCGGAGAGATCTCGAGATCTCTCCGGTGACGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001908.x-1648s1c1
Sequence:CCGGATCTATCGAGTTTGCAATGTCCTCGAGGACATTGCAAACTCGATAGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-238s1c1
Sequence:CCGGGCTGGTCAACTATGTCAACAACTCGAGTTGTTGACATAGTTGACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-358s1c1
Sequence:CCGGCCAGAGAGTTATGTTTACCGACTCGAGTCGGTAAACATAACTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-815s1c1
Sequence:CCGGGACAAGCACTACGGATACAATCTCGAGATTGTATCCGTAGTGCTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001908
VALIDATED
CTSB MISSION shRNA Lentiviral Transduction Particles
cathepsin B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001908.3-1251s21c1
Sequence:CCGGTTCACGTAAGATACAAGTTTCCTCGAGGAAACTTGTATCTTACGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001908.3-931s21c1
Sequence:CCGGTCGGACTTCCTGCTCTACAAGCTCGAGCTTGTAGAGCAGGAAGTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-952s1c1
Sequence:CCGGCCAACACGTCACCGGAGAGATCTCGAGATCTCTCCGGTGACGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001908.x-1648s1c1
Sequence:CCGGATCTATCGAGTTTGCAATGTCCTCGAGGACATTGCAAACTCGATAGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001908.x-238s1c1
Sequence:CCGGGCTGGTCAACTATGTCAACAACTCGAGTTGTTGACATAGTTGACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-358s1c1
Sequence:CCGGCCAGAGAGTTATGTTTACCGACTCGAGTCGGTAAACATAACTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001908.x-815s1c1
Sequence:CCGGGACAAGCACTACGGATACAATCTCGAGATTGTATCCGTAGTGCTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007798
VALIDATED
CTSB MISSION shRNA Bacterial Glycerol Stock
cathepsin B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-374s21c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-484s21c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-537s21c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-906s21c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-373s1c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-905s1c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-536s1c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-741s1c1
Sequence:CCGGAGGTGCAACAAGAGCTGTGAACTCGAGTTCACAGCTCTTGTTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-483s1c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007798
VALIDATED
CTSB MISSION shRNA shRNA Plasmid DNA
cathepsin B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-374s21c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-484s21c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-537s21c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-906s21c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-373s1c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-905s1c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-536s1c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-741s1c1
Sequence:CCGGAGGTGCAACAAGAGCTGTGAACTCGAGTTCACAGCTCTTGTTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-483s1c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007798
VALIDATED
CTSB MISSION shRNA Lentiviral Transduction Particles
cathepsin B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-374s21c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-484s21c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-537s21c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007798.2-906s21c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-373s1c1
Sequence:CCGGCCTTTGATGCACGGGAACAATCTCGAGATTGTTCCCGTGCATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-905s1c1
Sequence:CCGGGACTTACAAATCAGGAGTATACTCGAGTATACTCCTGATTTGTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-536s1c1
Sequence:CCGGCCTGCTTACTTGCTGTGGTATCTCGAGATACCACAGCAAGTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-741s1c1
Sequence:CCGGAGGTGCAACAAGAGCTGTGAACTCGAGTTCACAGCTCTTGTTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007798.1-483s1c1
Sequence:CCGGCGAACCTGCATTCACACCAATCTCGAGATTGGTGTGAATGCAGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)